TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination

Telangana TSBIEĀ TS Inter 2nd Year Zoology Study Material Lesson 2(b) Excretory Products and their Elimination Textbook Questions and Answers.

TS Inter 2nd Year Zoology Study Material Lesson 2(b) Excretory Products and their Elimination

Very Short Answer Type Questions

Question 1.
Name the blood vessels that enter and exit the kidney. [May 2017 (A.P.)]
Answer:
Renal artery enters the kidney and renal vein comes out of kidney.

Question 2.
What are renal pyramids and renal papillae?
Answer:
The medulla of kidney is divided into multiple cone shaped masses of tissue called renal pyramids. The base of each pyramid originates at the border between cortex and medulla and terminates in the renal papilla.

Question 3.
What are the columns of Bertin? [March 2019, 2015 (A.P.)]
Answer:
The renal pyramids are separated by the projections of the cortex called columns of Bertin (renal column).

Question 4.
Name the structural and functional unit of kidney. What are the two main types of structural units in it?
Answer:
Structural and functional unit of kidney is nephron. Each nephron has two types of structural units a) Bowman’s capsule and 2) the renal tubcile.

Question 5.
Distinguish between cortical and juxta medullary nephrons.
Answer:

  1. In a majority of nephrons, the loops of Henle is too short and extends only very little into the medulla. Such nephrons are called Cortical nephrons.
  2. In some of the nephrons, the loops of Henle are very long and run deep into the medulla. They are called Juxta medullary nephrons.

TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination

Question 6.
Define glomerular filtration. [Mar. ’14; May/June ’14; Mar. ’17 (A.P.)]
Answer:
Filtration of the blood from the glomerulus into the lumen of the Bowman’s capsule and this passive process is called glomerular filtration.

Question 7.
Define Glomerular Filtration Rate (GFR).
Answer:
The amount of filtrate formed by both the kidneys per minute is called Glomerular Filtration Rate (GFR).

Question 8.
What is meant by mandatory reabsorption? In which parts of nephron does it occur?
Answer:
About 85% of the filtrate formed is reabsorbed in a constant, unregulated fashion by the proximal convoluted tubule and descending limb of Henle’s loop. This is called obligatory or Mandatory reabsorption.

Question 9.
Distinguish between juxta glomerular cells and macula densa.
Answer:

  1. Juxta glomerular cells are present in Juxta glomerular apparatus where the afferent arteriole comes into contact with DCT. These are modified smooth muscle cells of the afferent arteriole.
  2. A group of modified epithelial cells of DCT which comes in contact with afferent arteriole are crowded in this region constitute macula densa.
    Macula densa together with JG cells form the JGA.

Question 10.
What is juxta glomerular apparatus? [March 2018 (A.P.)]
Answer:
The juxta Glomerular Aoparatus plays a complex regulating role. The JGA is the region in each nephron where the afferent arteriole comes into contact with DCT. Macula densa together with JG cells from the JGA.

TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination

Question 11.
Distinguish between the enzymes renin and rennin.
Answer:

  1. A fall in glomerular blood flow / glomerular blood pressure / GFR can activate the JG cells to release an enzyme called renin into the blood. This enzyme catalyses the conversion of angiotensinogen.
  2. Rennin is a digestive enzyme produced by gastric glands that converts milk into curd in infants. ‘

Question 12.
What is meant by the term osmoregulation?
Answer:
The process of maintaining the quantity of water and dissolved solutes in balance is referred to as osmoregulation.

Question 13.
What is the role of atrial natriuretic peptide in the regulation of urine formation?
Answer:
An increase in the flow of blood to the right atrium of the heart stretches its wall. It causes the release of atrial natriuretic peptide (ANP). It causes vasodilation and there by decrease the blood pressure. ANP mechanism therefore, acts as a counter check on the RAAS.

Short Answer Type Questions

Question 1.
Terrestrial animals are generally either ureotelic or uricotelic and not ammonotelic. Why?
Answer:
Aquatic animals excrete ammonia (ammonotelic) through body surface, gill surface etc. by diffuse. They can send ammonia through dilute urine as they can afford to lose much water. But that is not the case with terrestrial animals which may be excreting urea (ureotelic) or uric acid (uricotelic) water is the most important constituent of protoplasm, the living substance. Dehydration kills a person much faster than lack of food. Terrestrial adaptation necessitated the production of lesser toxic nitrogenous wastes such as urea and uric acid, for the conservation of water. Hence terrestrial animals are generally either ureotelic or uricotelic and not ammonotelic.

TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination

Question 2.
Differentiate vertebrates on the basis of the nitrogenous waste products they excrete, giving examples.
Answer:
Based on the nitrogenous waste products vertebrates are differentiated into 3 categories.
1. Ammonotelic animals :
Excrete nitrogenous Wastes in the form of ammonia, e.g.: Hydra, some bony fishes.

2. Ureotelic animals :
Excrete nitrogenous wastes in the form of urea, e.g.: Cartilaginous fishes, amphibians and mammals.

3. Uricotelic animals :
Excrete nitrogenous wastes in the form of uric acid, e.g.: Insects, reptiles and birds.

Question 3.
Draw a labelled diagram of the V.S. of Kidney.
Answer:
TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination 1

Question 4.
Describe the internal structure of kidney of man.
Answer:
Internal structure of Kidney :
A longitudinal section of the human kidney shows two distinct regions, the outer cortex and the inner medulla. The medulla is divided into multiple cone shaped masses of tissue called renal pyramids. The renal pyramids are separated by the projections of the cortex called columns of Bertin (renal column). The base of each pyramid originates at the border between the cortex and the medulla and terminates in the renal papilla. Renal papillae project into cup like calyces, formed by the funnel shaped pelvis, which continues out as the ureter.

Question 5.
Explain micturition.
Answer:
Micturition :
Urine formed by the nephrons is ultimately carried to the urinary bladder where it is stored till a voluntary signal is given by the central nervous system (CNS). This signal is initiated by the stretching of the urinary bladder as it gets filled with urine. In response, the stretch receptors on the walls of the bladder send signals to the CNS. The CNS passes on motor messages to initiate the contraction of smooth muscles of the bladder and simultaneous relaxation of the urethral sphincter, causing the release of urine. The process of passing out urine is called micturition and the neural mechanism involved is called ‘micturition reflex’.

Question 6.
What is the significance ofJuxta Glomerular Apparatus (JGA) in Kidney function?
Answer:
The Juxta Glomerular Apparatus plays a complex regulating role. The JGA is the region in each nephron where the afferent arteriole comes into contact with the DCT. A group of modified epithelial cells of the DCT are crowded in this region, constituting the macula densa. The wall of the afferent renal arteriole has JG cells (they are modified smooth muscle cells of the afferent arteriole). Macula densa together with JG cells form the JGA.

A fall in glomerular blood flow / glomerular blood pressure / GFR can activate the JG cells to release an enzyme called renin into the blood. This enzyme catalyses the conversion of angiotensinogen (a protein produced by the liver) into angiotensin I, which is converted into angiotensin II, by angiotensin converting enzyme (ACE). This conversion occurs primarily as blood passes through the capillaries of the lungs, where most of the converting enzyme is present. Angiotensin II stimulates the adrenal cortex to secrete aldosterone. Aldosterone causes reabsorption of Na+ and water from the DCT and CD to reduce loss through urine, and also promotes secretion of K+ ions into the DCT and CD. It leads to an increase in the blood pressure and GFR. This complex mechanism is generally known as renin – angiotensin – aldosterone system (RAAS).

An increase in the flow of blood to the right atrium of the heart stretches its wall. It causes the release of atrial natriuretic factor (ANF) / atrial natriuretic peptide (ANP). ANP can cause vasodilation (dilation of blood vessels) and there by decrease the blood pressure. ‘ANP’ mechanism therefore, acts as a counter check on the ‘RAAS’.

Question 7.
Give a brief account of the counter current mechanism.
Answer:
Mammals have the ability to produce concentrated urine. The Henle’s loop and vasa recta play a significant role in this. The flow of the renal filtrate in the two limbs of Henle’s loop is in opposite directions and thus forms a counter current. The flow of blood through the two limbs of vasa recta is also in a counter current pattern. The proximity between the Henle’s loop and vasa recta, as well as the counter currents of renal fluid and blood in them help in maintaining an increasing osmolarity towards the inner medullary interstitium. i.e., from 300 mOsml/ L in the cortex to about 120 mOsml/L in the inner medulla.

This gradient is mainly caused by NaCI and urea. NaCI passes out of the ascending limb of Henle’s loop, and it enters the blood of the descending limb of vasa recta. NaCI is returned to the interstitium from the ascending portion of the vasa recta. Similarly, small amounts of urea enter the thin segment of the ascending limb of Henle’s loop which is transported back to the interstitium, from the collecting duct.

TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination 2
Diagrammatic representation of a nephron and vasa recta showing counter current mechanisms

The above described transport of substances facilitated by the special arrangement of Henle’s loop and vasa recta is called the countercurrent mechanism (the two limbs of the loop of Henle constitute a counter current multiplier system). This mechanism helps to maintain a concentration gradient in the medullary interstitium. Presence of such interstitial gradient helps easy passage of water from the collecting duet, thereby concentrating the filtrate (urine). Human kidneys can produce urine nearly four times concentrated than the initial filtrate formed.

Question 8.
Explain the auto regulatory mechanism of GFR.
Answer:
The tubular epithelial cells in different segments of a nephron reabsorb certain substances of the glomerular filtrate either by active or passive mechanisms. About 85% of the filtrate formed is reabsorbed in a constant, unregulated fashion by the PCT and descending limb of Henle’s loop (obligatory or mandatory reabsorption) and the reabsorption of the rest of the fluid is “regulated”. Based on the necessity of re- absorption, the substances of glomerular filtrate can be categorized into ‘high threshold substances’ (essential and are efficiently reabsorbed e.g. glucose, amino acids, vitamins, some salts etc.,) ‘low threshold substances’ (absorbed in very little amounts e.g. urea, uric acid etc.) or ‘athreshold substances’ (actual excretory products and are not reabsorbed at all e.g. creatinine).

During the formation of urine, the tubular cells secrete substances such as H+, K+ and NH3 into the filtrate. Tubular secretion is also an important step in the formation of urine as it helps in the maintenance of ionic and acid – base balance of the body fluids.

TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination

Question 9.
Describe the role of liver, lungs and skin in excretion.
Answer:
In addition to the kidneys, lungs, liver and skin also help in the elimination of excretory wastes.
a) Lungs :
Lungs regularly eliminat about 18L of C02 and also significant amount of water per day in the form of water vapour in normal resting condition. The quantity of water loss increases in dry climates. Various volatile materials are also eliminated through the lungs.

b) Liver :
Liver is the largest gland in our body. It changes the decomposed haemoglobin of the worn-out RBCs into bile pigments, namely, bilirubin and biliverdin. These pigments pass into the alimentary canal along with the bile for elimination. The liver also excretes cholesterol, degraded steroid hormones, certain vitamins and drugs via bile.

c) Skin :
Human skin possesses two types of glands for the elimination of certain substances through their secretion.

  1. Sweat glands secrete a watery fluid called sweat. Primary function of sweat is to facilitate a cooling effect on the body surface. It also helps in the removal of some of the wastes like NaCI, small amounts of urea, lactic acid etc.
  2. Sebaceous glands eliminate certain substances like sterols, hydrocarbons, waxes through sebum. This secretion provides a protective ‘oily covering’ to the skin.

Question 10.
Name the following:
a) A chordate animal having protonephridial type excretory structure.
b) Cortical portions projecting between the medullary pyramids in the human kidney.
c) Capillary network paralleling the loop of Henle.
d) A non-chordate animal having green lands as excretory structure.
Answer:
a) A chordate animal having protonephridial type excretory structures is Lancelet (with solenocytes) or Amphioxus.

b) Cortical portions projecting between the medullary pyramids in the human kidney are columns of Bertin.

c) Capillary network paralleling the loop of Henle is vaserecta.

d) A non-chordate animal having green glands as excretory structures is crustaceans like prawn & crab.

Long Answer Type Questions

Question 1.
Describe the excretory system of man, giving the structure of a nephron. [March 2015 (T.S.)]
Answer:
Human Excretory System :
In humans, the excretory system consists of a pair of kidneys, a pair of ureters, a urinary bladder and urethra.

Kidneys :
Kidneys are reddish brown, bean shaped structures, situated on either side of the vertebral column between the levels of the last thoracic and third lumbar vertebrae, in a ‘retroperitoneal position’. The right kidney is slightly lower than the left one due to the presence of liver.

The outer surface of the kidney is convex and the inner surface has a deep notch called hilum, the point at which the renal artery and nerves enter and the renal vein and ureter leave. Each kidney is surrounded by a tough, fibrous capsule that protects its delicate inner surface.
TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination 3

Internal structure:
A longitudinal section of the human kidney shows two distinct regions, the outer cortex and the inner medulla. The medulla is divided into multiple cone shaped masses of tissue called renal pyramids. The renal pyramids are separated by the projections of the cortex called columns of Bertin (renal column). The base of each pyramid originates at the border between the cortex and the medulla and terminates in the renal papilla. Renal papillae project into cup like calyces, formed by the funnel shaped pelvis, which continues out as the ureter.
TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination 4

Ureters :
These are slender whitish tubes which emerge from the pelvis of the kidneys. Their walls are lined by ‘transitional epithelium’. The ureters run down wards and open into the urinary bladder.

Urinary bladder :
It is a median storage sac, situated in the lower abdominal cavity. It has thick, muscular, distensible wall lined by ‘transitional epithelium’. The neck of the bladder leads into the urethra, which has an internal urethral sphincter (made of smooth muscles) and external urethral sphincter (made of striped muscles). Urethra opens near the vaginal orifice in the female and through penis in the males.

Structure of a Nephron :
Each kidney has nearly one million nephrons which are the ‘structural’ and ‘functional’ units. Each nephron has two parts – the ‘Bowman’s capsule’ and the renal tubule. The Bowmans’ capsule encloses a tuft of capillaries called glomerulus, formed by the afferent renal arteriole – a fine branch of the renal artery. Blood from the glomerulus is carried away by an efferent renal arteriole of a lesser diameter. The blind end of the tubule forms a double walled cup called Bowman’s capsule, which surrounds the glomerulus.

The inner wall of the Bowman’s capsule has certain unique cells called podocytes which wrap around each capillary. The podocytes are arranged in an intricate manner so as to leave some minute spaces called ‘filtration slits’ or ‘slit pores’. The endothelial cells of the capillaries have numerous pores or ‘fenestrations’. The glomerulus along with the Bowman’s capsule constitutes the Malpighian body or renal corpuscle.

The tubule continues further and forms a highly coiled proximal convoluted tubule (PCT). A hairpin shaped Henle’s loop, which has descending and ascending limbs, is the next part of the tubule. The proximal part of the ascending limb is thin and the distal part is thick . The thick ascending limb continues into the distal convoluted tubule (DCT). The DCT continues as the ‘initial collecting duct’ in the cortex. Some initial collecting ducts unite to form a straight collecting duct, which passes through the medullary pyramid. In the medulla, the tubes of each pyramid join and form the duct of Bellini, which finally opens on the tip of the renal papilla. The contents of the duct of Bellini are discharged into the renal pelvis through the renal calyx.
TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination 5
A diagrammatic representation of a nephron showing blood vessels, collecting duct and tubule

The Malpighian corpuscle, PCT and DCT of a nephron are situated in the cortical region of the kidney, whereas the loop of Henle is in the medulla. In a majority of nephrons, the loop of Henle is too short and extends only very little into the medulla. Such nephrons are called cortical nephrons. In some of the nephrons, the loops of Henle are very long and run deep into the medulla. These nephrons are called juxtamedullary nephrons.

The efferent arteriole emerging from the glomerulus forms a fine capillary network called the peritubular capillaries, around the renal tubule. The portion of the peritubular capillaries that surrounds the loop of Henle is called the vasa recta. The vasa recta is absent or highly reduced in the cortical nephrons. The juxtamedullary nephrons possess well developed vasa recta.

TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination

Question 2.
Explain the physiology of urine formation. [March 2020]
Answer:
Urine Formation :
The formation of urine involves three main processes namely, glomerular filtration, selective reabsorption and tubular secretion.

a) Glomerular filtration :
The first step in the formation of urine is the ‘filtration’ of the blood from the glomerulus into the lumen of the Bowman’s capsule and this ‘passive’ (non -energy consuming process) process is called glomerular filtration. The hydrostatic pressure of the blood while flowing in the glomerulus is 60 mm Hg. It is opposed by ‘glomerular colloidal osmotic pressure’ of 32 mm Hg (which is exerted by the non-filtered plasma proteins of the blood in the glomerular capillaries) and Bowman’s capsular hydrostatic pressure of 18mm Hg. The net filtration pressure is 10mm Hg (60 – 32 + 18 = 10). This causes the filtration of blood through the 3 layered filtrate membrane formed by the endothelial cells of glomerular capillary together with the basement membrane and podocytes of the Bowman’s cup.

Blood is filtered through the fine slit pores and fenestrations due to the NFP. Therefore, this process is called ‘ultrafiltration’. The filtrate contains almost all the constituents of the plasma, except the proteins. The filtrate thus formed is called ultra – filtrate or ‘glomerular filtrate’ or ‘primary urine’, which is hypotonic to the cortical fluid. It passes into the next part of .the renal tubule.

b) Selective reabsorption and secretion :
The tubular epithelial cells in different segments of a nephron reabsorb certain substances of the glomerular filtrate either by active or passive mechanisms. About 85% of the filtrate formed is reabsorbed in a constant, unregulated fashion by the PCT and descending limb of Henle’s loop (obligatory or mandatory reabsorption) and the reabsorption of the rest of the fluid is ‘regulated’. Based on the necessity of re-absorption, the substances of glomerular filtrate can be categorized into ‘high threshold substances’ (essential and are efficiently reabsorbed e.g. glucose, amino acids, vitamins, some salts etc.), ‘low threshold substances’ (absorbed in very little amounts e.g. urea, uric acid etc), or ‘athreshold substances’ (actual excretory products and are not reabsorbed at all e.g. creatinine).

During the formation of urine, the tubular cells secrete substances such as H+, K+ and NH3 into the filtrate. Tubular secretion is also an important step in the formation of urine as it helps in the maintenance of ionic and acid-base balance of the body fluids. Mechanism of selective reabsorption and secretion in different parts of a nephron takes place as follows.

i) In the proximal convoluted tubule :
PCT is lined by simple cuboidal epithelium with ‘brush border’, which increases the surface area of absorption. Nearly all the essential nutrients and 70-80% of electrolytes and water are reabsorbed by this segment. Na+ is actively transported into the cortical interstitial fluid. This transfer of positive charge drives the passive transport of Cl. Glucose, amino acids, and other essential substances are also ‘actively’ transported. Movement of water occurs by ‘osmosis’.

PCT also helps to maintain the pH and ionic balance of the body fluids by selective secretion of hydrogen ions, and ammonia into the filtrate and by the absorption of HCO3 from it.

ii) In the Henle’s loop :
Reabsorption in this segment is minimum. However, this region plays a significant role in the maintenance of high osmolarity of the medullary interstitial fluid.

The descending limb of loop of Henle is permeable to water and almost impermeable to electrolytes, hence reabsorption of water continues as the filtrate moves along the descending limb (passive transport). As a result, the filtrate concentration gradually increases as it moves towards the inner medulla. The ascending limb has two specialized regions, a proximal thin segment, in which NaCI diffuses out into the interstitial fluid passively, and a distal thick segment, in which NaCI is actively pumped out. The ascending limb is impermeable to water. Thus the filtrate becomes progressively more dilute as it moves up to the cortex (towards the DCT).

TS Inter 2nd Year Zoology Study Material Chapter 2(b) Excretory Products and their Elimination 6
Reabsorption and secretion of major substances at different parts of the nephron (arrows indicate direction of movement of materials)

iii) In the distal convoluted tubule (DCT) :
The cells here are shorter than those in the proximal tubule and lack ‘microvilli’, indicating that they are not involved much in reabsorption ‘conditional reabsorption’ /’facultative reabsorption’ of Na+ and water takes place in this segment. The reabsorption of water is variable depending on several conditions and is regulated by ADH. DCT is also capable of reabsorption of HCO3 and selective secretion of H+ and K+ ions and NH3 into the DCT from the peritubular network, to maintain the pH and sodium – potassium balance in the blood.

iv) In the collecting duct (CD) :
This long duct carries the filtrate through the medulla to the renal pelvis. Considerable amount of water could be reabsorbed from the region to produce concentrated urine. This segment allows passage of small amount of urea to the medullary interstitum to keep up its osmolarity. It also plays a role in the maintenance of pH and ionic balance of blood by the selective secretion of H+ and K+ ions. The renal fluid after the process of facultative reabsorption in the CD, influenced by ADH, constitutes the ‘urine’, that is sent out. Urine in the CD is hypertonic to the plasma of blood.

TS Inter 2nd Year Zoology Study Material Chapter 2(a) Body Fluids and Circulation

Telangana TSBIEĀ TS Inter 2nd Year Zoology Study Material Lesson 2(a) Body Fluids and Circulation Textbook Questions and Answers.

TS Inter 2nd Year Zoology Study Material Lesson 2(a) Body Fluids and Circulation

Very Short Answer Type Questions

Question 1.
Write the differences between ‘open’ and ‘closed’ systems of circulation.
Answer:
a) open type :
In this type, blood flows from the heart into the arteries. The arteries open into large spaces called sinuses. From sinuses, blood is carried by the veins to the heart. There are no inter connecting vessels, capillaries between arteries and veins. It is found in leeches, arthropods, molluscs, and echinoderms.

b) Closed type :
In this type blood flows through blood vessels. Blood flows from arteries to the veins through capillaries. Closed type of blood vascular system is found in annelids, cephalopods among nonchordates and all vertebrates.

Question 2.
Sino-atrial node is called the pacemaker of our heart. Why?
Answer:
Sino atrial node consists of specialized cardiomyocytes. It has the ability to generate action potentials without any external stimuli, hence called pace maker of our heart.

Question 3.
What is the significance of artrioventricular node and antrioventricular bundle in the functioning of the heart?
Answer:
Atrio ventricular node (AV node) is a relay point that relays the action potentials received from the SA node to the ventricular musculature. A bundle of nodal fibres called atrioventricular bundle (His bundle / AV bundle) continues from the AV node into the interventricular septum. The action potentials received by AVN are conducted through atrioventricular bundle causing simultaneous ventricular systole.

Question 4.
Name the valves that guard the left and right atrioventricular apertures in man. [March 2015 (T.S.)]
Answer:
The left atrio ventricular aperture is guarded by bicuspid or mitral valve. The right atrio ventricular aperture is guarded by tricuspid valve.

Question 5.
Where is the valve of Thebesius in the heart of man?
Answer:
The valve of the besius is situated where the coronary sinus opens into the right atrium of heart.

TS Inter 2nd Year Zoology Study Material Chapter 2(a) Body Fluids and Circulation

Question 6.
Name the aortic arches arising from the ventricles of the heart of man.
Answer:
The aortic arches arising from the ventricles of the heart of man are.

  1. Pulmonary arch whose opening is guarded by pulmonary valve.
  2. Systemic arch whose opening is guarded by aortic valve.
    Both valves are made up of 3 semilunar flaps each.

Question 7.
Name the heart sounds. When are they produced?
Answer:
Heart sounds are named as LUB and DUP.

  1. The first heart sound LUB is produced when atrioventricular valves (AV valves) close preventing the back flow of blood.
  2. The second heart sound DUP is produced when the semilunar valves close preventing the back flow of blood.

Question 8.
Define cardiac cycle and cardiac output. [March 2020]
Answer:

  1. The cardiac events that occur from the beginning of one heart beat to the beginning of the next constitute a cardiac cycle.
  2. The volume of blood pumped out by the heart from each ventricle per minute is termed cardiac output.

Question 9.
What is meant by double circulation? What is its significance?
Answer:
In this type of circulation blood circulate twice (two times) through the heart to complete circuit. There are two circuits.

  1. Lesser circulation i.e., pulmonary circulation.
  2. Greater circulation i.e., systemic circulation. Oxygenated and deoxygenated bloods never mix.

Question 10.
Why the arteries are more elastic than the veins?
Answer:
Arteries are most elastic than the veins because arteries and arterioles have two elastic laminae one on either side of the muscle layer. Veins have one elastic lamina inner to the muscle layer. The muscle layer is much thicker in the arteries than in the veins.

Short Answer Type Questions

Question 1.
Describe the evolutionary change in the structural pattern of the heart among the vertebrates.
Answer:
In the vertebrates the principal differences in the blood vascular system involve the gradual differentiation of the heart into two separate pumps as they evolved from the gill breathing aquatic life to the lung breathing complete terrestrial life.

Fishes have a 2 – chambered heart with an atrium and a ventricle. It pumps out deoxygenated blood to gills for oxygenation, hence the name ‘branchial heart’. Blood passes through the heart only once in a complete circuit, hence called single circulation.

Amphibians have a 3 – chambered heart with two atria and one ventricle. Reptile have two atria and an incompletely divided ventricle (except in the crocodiles in which the ventricle is divided into two chambers). The left atrium receives oxygenated blood from the gills/ lungs /skin and the right atrium receives deoxygenated blood from the other parts of the body through the venae cavae. However, the two types of blood get mixed up in the single ventricle, which pumps out mixed type of blood. Thus these animals (amphibians and reptiles) show an incomplete double circulation.

Birds and mammals possess a 4 – chambered heart with two atria and two ventricles. In these animals the oxygenated and the deoxygenated types of blood received by the left and right atria passes on to the left and right ventricles, respectively. The ventricles pump the blood out without any mixing of the oxygenated and deoxygenated types of blood i.e., there are two completely separate circulatory pathways namely systemic and pulmonary circulations. Hence, these animals are said to be showing ‘double circulation’.

TS Inter 2nd Year Zoology Study Material Chapter 2(a) Body Fluids and Circulation

Question 2.
Describe atria of the heart of man.
Answer:
Atria of the heart of man :
Atria are thin walled ‘receiving chambers’ (upper chambers). The right one is larger than the left. The two atria are separated by thin inter -atrial septum. In the fetal heart, the atrial septum has a small pore called foramen ovale. Normally the foramen ovale closes at birth, when lungs become functional. It is represented by a depression in the septum between the right and left atria, called fossa ovalis (that marks the position of the foramen ovale in the fetus). If, the foramen ovale does not close properly, it is called a patent foramen ovale.

The right atrium receives deoxygenated blood from different parts of the body (except the lungs) through three caval veins viz. the two precavals (right and left) and a post caval vein. It also receives blood from the myocardium (wall of the heart) through the coronary sinus, whose opening into the right atrium is guarded by the valve of Thebesius. Opening of the postcaval vein is guarded by the valve of the inferior vena cava or Eustachian valve. It directs the blood to the left atrium through the foramen ovale, in the foetal stage, but in the adult it becomes rudimentary and non – functional. The openings of the precaval veins into the right atrium have no valves. The left atrium receives blood from each lung through two pulmonary veins, which open into the left atrium. The two left pulmonary veins open by a common aperture in some.

Atria and ventricles are separated by a membranous atrio – ventricular septum, which possesses left and right atrioventricular apertures. The left and right apertures are guarded by bicuspid (mitral valve) and tricuspid valves respectively.

Question 3.
Describe the ventricles of the heart of man.
Answer:
Ventricles :
These are the thick walled blood pumping chambers (lower chambers), separated by an interventricular septum. The wall of the left ventricle is thicker than that of the right ventricle. The inner surface of the ventricles is raised into muscular ridges or columns called columnae carneae / trabeculae carneae projecting from the inner walls of the ventricles. Some of these ridges are large and conical, and are called papillary muscles, whose apices are connected to the chordae tendineae, or ‘heart strings’. They are cord – like collagenous processes that connect the papillary muscles to the tricuspid valve and the mitral valve in the heart. They prevent the cusps of the atrioventricular valves from bulging too far into atria during ventricular systole.

Question 4.
Draw a labelled diagram of the L.S of the heart of man.
Answer:
TS Inter 2nd Year Zoology Study Material Chapter 2(a) Body Fluids and Circulation 1

Question 5.
Describe the events in a cardiac cycle; briefly.
Answer:
Cardiac cycle :
The cardiac cycle consists of three phases, namely atrial systole, ventricular systole and cardiac diastole.

To begin with, all the four chambers of the heart are in a relaxed state / joint diastole stage. Blood from the pulmonary veins and venae cavae flows into the respective atria. As the A – V valves are in open condition, blood flows into the left and right ventricles, through the left and right atrioventricular apertures. The semilunar valves of the pulmonary and aortic arches are closed at this stage.

Atrial systole :
The SAN now generates an action potential which stimulates both the atria to contract simultaneously causing the ‘atrial systole’. It lasts about 0. 1 sec. This increases the flow of blood into the ventricles by about 30%. It means atrial systole accounts for about 30% of the filling of the ventricles, the remaining blood flows into the ventricles before the atrial systole.

Ventricular systole :
The action potentials from the SAN reach the AVN from where they are conducted through the bundle of His, its branches and the Purkinje fibres to the entire ventricular musculature. This causes the simultaneous ventricular systole. It lasts for about 0.3 sec. The atria undergo relaxation coinciding with the ventricular systole. Ventricular systole increases the pressure causing the closure of the AV valves preventing the ‘backflow’ of blood. It results in the production of the first heart sound known as ‘Lub’. As the ventricular pressure increases further, the semilunar valves guarding the pulmonary artery and the aorta are forced open. This allows the blood in the ventricles to flow into the aortic arches and enter the circulatory pathway.

Cardiac diastole :
The ventricles now relax and the ventricular pressure falls causing the closure of the semilunar valves which prevents the back flow of blood. This results in the production of the second heart sound known as ‘Dup’. As the ventricular pressure declines further, the AV valves are pushed open by the pressure in the atria exerted by the blood, which flowed into them through the larger veins.

TS Inter 2nd Year Zoology Study Material Chapter 2(a) Body Fluids and Circulation

Question 6.
Explain the mechanism of clotting of blood.
Answer:
Mechanism of blood clotting:
Clotting takes place in three essential steps.
i) Step – 1 :
It involves the formation of a complex of activated substances collectively called, prothrombin activator. It is formed by a complex cascade of chemical reactions that occur in the blood by the involvement of clotting factors in two pathways.

a) Intrinsic pathway :
It occurs when the blood is exposed to collagen of injured wall of blood vessel. This activates Factor XII, and in turn it activates another clotting factor, which activates yet another reaction (cascade fashion) which results in the formation of the prothrombin activator.

b) Extrinsic pathway :
It occurs when the damaged vascular waH or extra vascular tissue comes into contact with blood. This activates the release of tissue thromboplastin, from the damaged tissue. It activates the Factor VII . As a result of these cascade reactions, the final product formed is the prothrombin activator.

ii) Step – 2 :
The prothrombin activator, in the presence of sufficient amounts of ionic Ca++, causes the conversion of inactive prothrombin to active thrombin (activation of prothrombin).

iii) Step – 3 :
Thrombin converts the soluble protein fibrinogen into soluble fibrin monomers, which are held together by weak hydrogen bonds. The fibrin stabilizing factor (Factor XIII, released from platelets) replaces hydrogen bonds with covalent bonds and cross links the fibres to form a ‘mesh work . The insoluble mesh work of fibrin fibers spreading in all directions adhere to the damaged surfaces and trap the blood cells and platelets.

Question 7.
Distinguish between SAN and AVN.
Answer:
A specialized cardiac musculature called the nodal tissue is also distributed in the heart. A patch of this tissue called the sinoatrial node (SAN) is present in the right upper corner of the right atrium near the openings of the superior venae cavae. Another mass of this tissue, called the atrioventricular node (AVN), is seen in the lower left corner of the right atrium close to the atrioventricular septum. A bundle of nodal fibres, called atrioventricular bundle (AV Bundle / ‘His’ bundle) continues from the AVN into the inter-ventricular septum. It divides into right and left bundle branches. These branches give rise to minute fibres called purkinje fibres that extend throughout the ventricular musculature / walls of the respective sides. SAN consists of specialized cardiomyocytes. It has the ability to generate action potentials without any external stimuli, hence called pacemaker. AV mode is a relay point.

Question 8.
Distinguish between arteries and veins.
Answer:
Differences between arteries and veins.

arteriesVeins
1) Arteries carry oxygenated blood, away from the heart (except the pulmonary artery).1) Veins carry deoxygenated blood, towards the heart (except the pulmonary veins).
2) These are bright red in colour.2) These are dark red in colour.
3) These are mostly deep seated in the body.3) Veins are generally superficial.
4) Arteries are thick – walled as the tunica media is relatively thick, with elastin and smooth muscles.4) Veins are thin walled (tunica media is relatively thin with few elastin fibres) and slightly muscular.
5) Lumen is narrow5) Lumen is wide
6) Non – valvular.6) Valvular
7) Blood in the arteries flows with more pressure and by jerks.7) Blood in the veins flows steadily with relatively low pressure
8) Arteries end in capillaries.8) Veins start with capillaries.

Long Answer Type Questions

Question 1.
Describe the structure of the heart of man with the help of neat labelled diagram. [March 2018 (A.P.); March 2014; May/June ’14]
Answer:
The heart is mesodermal in origin. It is a thick walled, muscular and pulsating organ, situated in the mediastinum (the region in the thorax between the two lungs), and with its apex slighty turned to the left. It is the size of a clinched fist.

The heart is covered by a double walled pericardium which consists of the outer fibrous pericardium and the inner serous pericardium is double – layered, formed of an outer parietal layer and an inner visceral layer. The parietal layer is fused with the fibrous pericardium, whereas the visceral layer adheres to the surface of the heart and forms its outer layer, the epicardium. The two layers are separated by a narrow pericardial space, which is filled with the pericardial fluid. This fluid reduces friction between the two membranes and allows free movement of the heart.

The wall of the heart consists of three layers. They are the outer epicardium, the middle myocardium (a thick layer of cardiac muscles), and the inner most endocardium (a thin layer of endothelium). The endothelium covers the heart valves also and is continuous with the endothelial lining of the large blood vessels connected to the heart.

External structure:
Human heart has four chambers, with two relatively smaller upper chambers, called atria and two larger lower chambers called ventricles. Atria and ventricles are separated by a deep transverse groove called coronary sulcus (atrio – ventricular groove). The muscular pouch like projection from each atrium is called auricular appendix (auricular appendage). The ventricles are separated by two inter ventricular grooves (anterior and posterior), in which the coronary arteries and their branches are lodged.
TS Inter 2nd Year Zoology Study Material Chapter 2(a) Body Fluids and Circulation 2

Internal structure:
i) Atria :
Atria are thin walled ‘receiving chambers’ (upper chambers). The right one is larger than the left. The two atria are separated by thin inter-atrial septum. In the fetal heart, the atrial septum has a small pore called foramen ovale. Normally the foramen ovale closes at birth, when lungs become functional. It is represented by a depression in the septum between the right and left atria, called fossa ovalis (that marks the position of the foramen ovale in the fetus). If, the foramen ovale does not close properly, it is called a patent foramen ovale.

The right atrium receives deoxygenated blood from different parts of the body (except the lungs) through three caval veins viz. the two precavals (right and left) and a post caval vein. It also receives blood from the myocardium (wall of the heart) through the coronary sinus, whose opening into the right atrium is guarded by the valve of Thebesius. Opening of the postcaval vein is guarded by the valve of the inferior vena cava or Eustachian valve. It directs the blood to the left atrium through the foramen ovale, in the foetal stage, but in the adult it becomes rudimentary and non – functional. The openings of the precaval veins into the right atrium have no valves. The left atrium receives blood from each lung through two pulmonary veins, which open into the left atrium. The two left pulmonary veins open by a common aperture in some.
TS Inter 2nd Year Zoology Study Material Chapter 2(a) Body Fluids and Circulation 3

Atria and ventricles are separated by a membranous atrio – ventricular septum, which possesses left and right atrioventricular apertures. The left and right apertures are guarded by bicuspid (mitral valve) and tricuspid valves respectively.

ii) Ventricles :
These are the thick walled blood pumping chambers (lower chambers), separated by an interventricular septum. The wall of the left ventricle is thicker than that of the right ventricle. The inner surface of the ventricles is raised into muscular ridges or columns called columnae carneae / trabeculae carneae projecting from the inner walls of the ventricles. Some of these ridges are large and conical, and are called papillary muscles, whose apices are connected to the chordae tendineae, or ‘heart strings’. They are cord – like collagenous processes that connect the papillary muscles to the tricuspid valve and the mitral valve in the heart. They prevent the cusps of the atrioventricular valves from bulging too far into atria during ventricular systole.

TS Inter 2nd Year Zoology Study Material Chapter 2(a) Body Fluids and Circulation

Question 2.
Write notes on the working of the heart of man.
Answer:
The cardiac events that occur from the beginning of one heart beat to the beginning of the next constitute a cardiac cycle. This cardiac cycle consists of three phases, namely atrial systole, ventricular systole and cardiac diastole.

To begin with, all the fpur chambers of the heart are in a relaxed state / joint diastole stage. Blood from the pulmonary veins and venae cavae flows into the respective atria. As the A – V valves are in open condition, blood flows into the left and right ventricles, through the left and right atrioventricular apertures. The semilunar valves of the pulmonary and aortic arches are closed at this stage.

Atrial systole :
The SAN now generates an action potential which stimulates both the atria to contract simultaneously causing the ‘atrial systole’. It lasts about 0. 1 sec. This increases the flow of blood into the ventricles by about 30%. It means atrial systole accounts for about 30% of the filling of the ventricles, the remaining blood flows into the ventricles before the atrial systole.

Ventricular systole :
The action potentials from the SAN reach the AVN from where they are conducted through the bundle of His, its branches and the Purkinje fibres to the entire ventricular musculature. This causes the simultaneous ventricular systole. It lasts for about 0.3 sec. The atria undergo relaxation coinciding with the ventricular systole. Ventricular systole increases the pressure causing the closure of the AV valves preventing the ‘backflow’ of blood. It results in the production of the first heart sound known as ‘Lub’. As the ventricular pressure increases further, the semilunar valves guarding the pulmonary artery and the aorta are forced open. This allows the blood in the ventricles to flow into the aortic arches and enter the circulatory pathway.

Cardiac diastole :
The ventricles now relax and the ventricular pressure falls causing the closure of the semilunar valves which prevents the back flow of blood. This result in the production of the second heart sound known as ‘Dup’. As the ventricular pressure declines further, the AV valves are pushed open by the pressure in the atria exerted by the blood, which flowed into them through the larger veins. The blood now once again flows freely into the ventricles. All the heart chambers are now again in a relaxed state (joint diastolic phase). Soon, another cardiac cycle sets in.

Cardiac output :
The volume of blood pumped out by each ventricle, for each heart beat, is known as the stroke volume. The volume of blood pumped out by the heart from each ventricle per minute is termed cardiac output.

Cardiac output = Stroke volume Ɨ No. of beats per minute = 70 ml / beat Ɨ 72 beats / minute = 5040 ml/ min. or approximately 5 litres.

TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases

Telangana TSBIEĀ TS Inter 2nd Year Zoology Study Material Lesson 1(b) Breathing and Exchange of Gases Textbook Questions and Answers.

TS Inter 2nd Year Zoology Study Material Lesson 1(b) Breathing and Exchange of Gases

Very Short Answer Type Questions

Question 1.
Define vital capacity. What is its significance?
Answer:
Vital Capacity (VC) :
The maximum volume of air a person can breathe in after forced expiration. This includes ERV, TV and IRV or the maximum volume of air a person can breathe out after forced inspiration.
VC = TV + IRV + ERV

Question 2.
What is the volume of air remaining in lungs after a normal expiration?
Answer:
The volume of air that remains in the lungs after normal expiration is called Functional Residual Capacity (FRC).
FRC = ERV + RV

Question 3.
Diffusion of oxygen occurs in the alveolar region only and not in the other parts of respiratory system. How do you justify the statement?
Answer:
Alveoli are primary sites of exchange of gases in the lungs. The diffusion membrane of Alveoli is made up of 3 major layers like thin squamous epithelium of Alveolar wall, the endothelium of the alveolar capillaries and the basement material in between them. As it is a very thin border, it is favourable for diffusion of gases.

Question 4.
What is the effect of pCO2 on oxygen transport?
Answer:
The effect of pCO2 and H+ concentration on the oxygen affinity of haemoglobin is called Bohr effect. (A rise in pCO2 and fall in pH decreases the affinity of haemoglobin for oxygen. On other hand a fall in pCO2 and rise in pH increases affinity of haemoglobin for oxygen).

Question 5.
What happens to the respiratory process in a man going up a hill?
Answer:
At a height of about 6000 m the pO2 becomes almost half of what it is at the mean sea level, hence the mountain sickness in people ascending mountains.

TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases

Question 6.
What is Tidal volume? Find out the Tidal volume (approximate value) in a healthy human, in an hour?
Answer:
Volume of air inspired or expired during normal inspiration or expiration. It is approximately 500 ml. A healthy man can inhale or exhale approximately per hour is 3,60,000 -4,80,000 ml.

Question 7.
Define oxyhaemoglobin dissociation curve. Can you suggest any reason for its sigmoidal pattern?
Answer:
A sigmoid curve is obtained when percentage saturation of haemoglobin with O2 is plotted against the pO2. This curve is called oxyhaemoglobin dissociation curve. At normal condition that is on pCO2 of 40mm Hg concentration, this curve is sigmoid and normal. By increasing concentration of CO2 curve shifted towards rightside. By decreasing, concentration of CO2 curve shifted towards left side.

Question 8.
What are conchae?
Answer:
Nasal chamber of human being is divided into 3 parts namely vestibularpart, respiratory part and olfactory part. In respiratory part, it has three thin twisted bony plates called turbinals or conchae.

Question 9.
What is meant by chloride shift? [March 2014]
Answer:
The exchange of chloride and bicarbonate ions between RBC and plasma at the tissues is called chloride shift or Hamburger’s phenomenon or Hamburger’s shift.

Question 10.
Mention any two occupational respiratory disorders and their causes in human beings. [March 2018(A.P)]
Answer:
Two occupational respiratory disorders are
a) Asbestosis :
It occurs due to chronic exposure to asbestos dust in the people working in asbestos industry.

b) Black lung disease :
It is a lung disease that develops from inhalation of coal dust. It is common in long time coal mine workers.

TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases

Question 11.
Name the muscles that help in normal breathing movements.
Answer:
Normal breathing movements are aided by

  1. Phrenic muscles of diaphragm
  2. External and internal intercostal muscles of ribs.

Question 12.
Draw a diagram of oxyhaemoglobin dissociation curve.
Answer:
TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases 1

Short Answer Type Questions

Question 1.
Explain the process of inspiration and expiration under normal conditions? [March 2015 (T.S.)]
Answer:
Inspiration :
Intake of atmospheric air into the lungs is called inspiration. It is an active process, as it takes place by the contraction of the muscles of the diaphragm and the external inter-costal muscles, which extend in between the ribs. The contraction of the diaphragm (phrenic muscles) increases the volume of the thoracic chamber in the antero-posterior axis. The contraction of external intercostal muscles lifts up the ribs and sternum causing an increase in the volume of the thoracic chamber in the dorso – ventral axis. The overall increase in the thoracic volume causes a similar increase in the ‘pulmonary volume’. An increase in the pulmonary volume decreases the intra – pulmonary pressure to less than that of the atmosphere, which forces the air from the outside to move into the lungs, i.e., inspiration.

Expiration :
Release of alveolar air to the exterior is called expiration. It is a passive process. Relaxation of the diaphragm and the external inter – costal muscles returns the diaphragm and sternum to their normal positions, and reduces the thoracic volume and thereby the pulmonary volume. This leads to an increase in the intra – pulmonary pressure to slightly above that of the atmospheric pressure, causing the expulsion of air from the lungs, i.e., expiration.

Question 2.
What are the major transport mechanisms for CO2? Explain. [March 20191 May 2017 (A.P.)]
Answer:
Transport of Carbon Dioxide : CO2 is transported in three ways.
i) In dissolved state :
7 percent of CO2 is carried in a dissolved state (physical solution) through plasma.
CO2 + H2O → H2CO3

ii) As carbamino compounds :
About 20-25 percent of CO2 combines directly with free amino group of the haemoglobin and forms carbamino-haemoglobin in a reversible manner.
Hb – NH2 + CO2 → Hb – NHCOO + H+

This binding of CO2 is related to the partial pressure of CO2. pO2 is a major factor which could affect this binding. When pCO2 is high and pO2 is low as in the tissues, binding of more carbon dioxide occurs. When pCO2 is low and pO2 is high as in the alveoli, dissociation of CO2 from carbamino – haemoglobin takes place, i.e., CO2 which is bound to haemoglobin from the tissues is delivered at the alveoli. Carbamino compounds are also formed by the union of CO2 with plasma proteins.

iii) As Bicarbonates: About 70 percent of CO2 is transported as bicarbonate. RBCs contain a very high concentration of the enzyme, carbonic anhydrase and a minute quantity of the same is present in the plasma too. This enzyme facilitates the following reaction in both the directions.
TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases 2

At the tissues where partial pressure of CO2 is high due to catabolism, CO2 diffuses into the blood (RBC and Plasma) and forms carbonic acid which dissociates into HCO3 and H+. At the alveolar site where pCO2 is low, the reaction proceeds in the opposite direction leading to the formation of CO2and water. Thus CO2 is mostly trapped as bicarbonate at the tissues and transported to the alveoli where it is released out as CO2.

TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases

Question 3.
How is respiratory movements regulated in Man? [March 2018 (A.P); March 2014]
Answer:
Respiratory movements are regulated in Man by neural system

  1. A special centre present in the medulla region of brain called “Respiratory rhythm centre” is primarily responsible for this regulation.
  2. Another centre present in the pons of the brain stem called ‘Pneumotaxic Centre’ can moderate the functions of the ‘respiratory rhythm centre1. Neural signal from this centre can reduce the duration of inspiration and there by alter the respiratory rate.
  3. A chemo – sensitive area is situated adjacent to the respiratory rhythm centre which is highly sensitive to CO2 and hydrogen ions. Increase in these substances can activate this centre, which inturn can send signals to the respiratory rhythm centre to make necessary adjustments in the respiratory process by which these substances can be eliminated.
  4. Receptors associated with aortic arch and carotid artery also recognize changes in CO2 and H+ concentration and send necessary signals to the respiratory rhythm centre for necessary actions (increase in the rate and depth of breathing when their concentration is high). The role of oxygen in the regulation of the respiratory rhythm is quite insignificant.

4. Distinguish between
a) IRV and ERV
b) Inspiratory Capacity and Expiratory Capacity.
c) Vital capacity and Total lung capacity.
Answer:
a) IRV and EftV :
IRV is the maximum volume of air that can be inhaled during forced breathing in addition to the tidal volume. This is about 2500 ml 3000 ml. ERV is the maximum volume of air that can be exhaled during forced breathing in addition to the tidal volume. This is about 1000 ml to 1100 ml.

b) Inspiratory Capacity and Expiratory Capacity (1C):
Inspiratory Capacity :
The total volume of air a person can inhale after normal expiration. This includes the tidal volume and inspiratory reserve volume i.e., Ic = TV + IRV. It is about 3000 ml to 3500 ml.

Expiratory Capacity :
The total volume of air a person can exhale after normal inspiration. This includes tidal volume and expiratory reserve volume. TV + ERV. It is about 1500 ml to 1600 ml.

c) Vital capacity and Total lung capacity :
The maximum volume of air a person can breathe in after forced expiration is called vital capacity. This includes ERV, TV and IRV.

Total lung Capacity :
The total volume of air accommodated in the lungs at the end of forced inspiration. This includes RV, ERV, TV and IRV.

Question 5.
Describe disorders of respiratory system. [Mar. ’20, ’17, ’15 (A.P.); May ’14]
Answer:
Disorders of the Respiratory System :
i) Asthma is a difficulty in breathing caused due to inflammation of bronchi and bronchioles. It is characterized by the spasm of smooth muscles present in the walls of the bronchi and bronchioles. Symptoms include coughing, difficulty in breathing and wheezing. In the case of asthma, the allergen causes release of histamine and other inflammatory substances which cause constriction of the bronchi.

ii) Emphysema is a chronic disorder in which alveolar walls are damaged and their walls coalesce due to which respiratory surface area of exchange of gases is decreased. The lung shows larger but fewer alveoli and more fibrous and less elastic. One of the major causes of this is ‘smoking’ of tobacco.

iii) Bronchitis is the inflammation of the bronchi, resulting in the swelling of mucous lining of bronchi, increased mucus production and decrease in the diameter of bronchi. Symptoms include chronic cough with thick mucus/ sputum (phlegm).

iv) Pneumonia is infection of lungs caused by bacteria such as Streptococcus pneumoniae and also by certain viruses, fungi, protozoans and mycoplasmas. Symptoms include inflammation of lungs, accumulation of mucus in alveoli, and impaired exchange of gases, leading to death if untreated.

v) Emphysema, chronic bronchitis and asthma come under Chronic Obstructive Pulmonary Diseases (COPDs).

Occupational Respiratory disorders :
These are caused by exposure of the body to the harmful substances from certain industries, especially those involving grinding or stone breaking. Long term exposure of the body to such substances can give rise to inflammation of respiratory passage and lungs leading to several disorders.

i) Asbestosis :
It occurs due to chronic exposure to asbestos dust in the people working in asbestos industry.

ii) Silicosis :
It occurs because of long term exposure to ‘silica dust’ in the people working in mining industries, quarries etc.

iii) Siderosis :
It occurs due to deposition of iron particles in tissues. It can cause different types of siderosis such as pneumoconiosis due to inhalation of iron particles, hyperferremia and hemosiderosis (which causes recurrent alveolar hemorrhage).

iv) Black-lung disease :
It is a lung disease that develops from inhalation of coal dust. It is common in long time coal mine workers.

Long Answer Type Questions

Question 1.
Describe the respiratory system in man.
Answer:
Human Respiratory System : Respiratory system of man includes the following :

I) External nostrils (External Nares) :
A pair of external nostrils opens out above the upper lip. They lead into nasal chambers through the nasal passages.

II) Nasal Chambers :
They lie above the palate and are separated from each other by a nasal septum. Each nasal chamber can be differentiated into three parts namely, (i) vestibular part (which has hair and sebaceous glands to prevent the entry of dust particles), (ii) respiratory part (which is involved in the conditioning the temperature of inhaled air, it has three thin, twisted bony plates called turbinals / conchae) and (iii) olfactory part (which is lined by an olfactory epithelium).

III) Naso-pharynx :
Nasal chambers lead into nasopharynx through a pair of internal nostrils, located above the soft palate. Nasopharynx is a portion of the pharynx, the common chamber for the passage of food and air. Nasopharynx leads into oropharynx and opens through glottis of larynx into the trachea.

IV) Larynx :
Larynx is a cartilaginous box which helps in sound production, hence called the voice box. Wall of larynx is supported by nine cartilages. Thyroid, cricoid and epiglottis are the unpaired cartilages, whereas corniculate cartilages (cartilages of Santorini – two small conical nodules of elastic cartilage articulating with the arytenoid cartilages), arytenoids, and cuneiform cartilages are the paired cartilages. Epiglottis is a thin leaf like elastic cartilaginous flap attached to the thyroid cartilage to prevent the entry of food into the larynx through the glottis. The yellow elastic fibres which connect the thyroid and arytenoid cartilages are called vocal cords / vocal folds. The space between the true vocal cords and the arytenoids cartilages is called rima glottidis.

The mid ventral part of the thyroid cartilage forms the laryngeal prominence called Adam’s apple.
In males, the vocal cords are thicker, longer, and produce low pitch voice, where as in women and children the vocal cords are usually short and produce high pitch voice.

V) Trachea :
Trachea, the wind pipe is a straight tube extending up to the mid – thoracic cavity. The wall of the trachea is supported by ‘C’ shaped rings of hyaline cartilage. These rings are incomplete dorsally and keep the trachea always open preventing collapse. Internally the trachea is lined by pseudostratified ciliated epithelium.
TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases 3

VI) Bronchi and Bronchioles :
On entering the mid thoracic cavity, trachea divides at the level of the fifth thoracic vertebra into right and left primary bronchi. Each primary bronchus enters the corresponding lung and divides into secondary bronchi that further divide into tertiary bronchi. Each tertiary bronchus divides and re – divides to form primary, secondary, tertiary terminal and respiratory bronchioles sequentially. Each respiratory bronchiole terminates in a cluster of alveolar ducts which end alveolar sacs. Bronchi and initial bronchioles re supported by incomplete cartilaginous rings. The branching network of trachea, bronchi and bronchioles constitute the’pulmonary tree’ (an upside down tree).

VII) Lungs :
Lungs occupy the greater part of the thoracic cavity. Lungs are covered by a double layered pleura, with pleural fluid between them. It reduces friction on the lung surface. The outer pleural membrane is in close contact with the thoracic lining whereas the inner pleural membrane is in contact with lung’s surface. The part starting with external nostrils up to the terminal bronchioles constitute the conducting part, whereas the alveoli and their ducts form the respiratory or exchange part of the respiratory system. The conducting part transports the atmospheric air to the alveoli, clears it from foreign particles, humidifies and also brings the inhaled air to the body temperature. Exchange part is the site of actual diffusion of and between blood and atmospheric air.

The lungs are situated in the thoracic chamber which is anatomically an air – tight chamber. It is formed dorsally by the vertebral column, ventrally the sternum, laterally by ribs and on the lower side by the dome – shaped diaphragm. The anatomical setup of lungs in the thorax is such that any change in the volume of thoracic cavity will be reflected in the lung cavity. Such an arrangement is essential for breathing, as the pulmonary volume cannot be directly altered.

TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases 4
Diagrammatic view of human respiratory system
(Sectional view of the left lung is also shown)

TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases

Question 2.
Write an essay on the transport of oxygen and carbon dioxide by blood.
Answer:
Transport of gases :
Blood is the medium of transport for O2 and CO2.

I. Transport of Oxygen :
Oxygen is transported from the lungs to the tissues through the plasma and RBC of the blood. 100 ml of oxygenated blood can deliver 5 ml of o2 to the tissues under normal conditions.
i) Transport of oxygen through plasma :
About 3% of 02 is carried through the blood plasma in a dissolved state.

TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases 1
ii) Transport of oxygen by RBC :
About 97% of O2 is transported by the RBCs in the blood. Haemoglobin is a red coloured iron containing pigment present in the RBCs. Each haemoglobin molecule can carry a maximum of four molecules of oxygen. Binding of oxygen with haemoglobin is primarily related to the partial pressure of O2. At lungs, where the partial pressure of O2 (oxygen tension) is high, pO2 (mmHg) oxygen binds to haemoglobin (purplish – bluish-red in colour) in a reversible manner to form oxyhaemoglobin (bright red in colour). This is called oxygenation of haemoglobin.
Hb + 4O2 → Hb (O2)4

At the tissues, where the partial pressure of 02 is low, oxyhaemoglobin dissociates into haemoglobin and oxygen. The other factors that influence binding of oxygen with haemoglobin are the partial pressure of C02, the hydrogen ion concentration (pH) and the temperature.

iii) Oxygen – haemoglobin dissociation curve :
It explains the relation between percentage saturation of haemoglobin and partial pressure of oxygen. A sigmoid curve is obtained when percentage saturation of haemoglobin with O2 is plotted against the pO2. This curve is called ‘oxyhaemoglobin dissociation curve’ and is highly useful in studying the effect of factors such as pCO2, H+ concentration, temperature, etc., on the binding of O2 with haemoglobin. In the alveoli, where there is a high pO2, low pCO2, lesser H+ concentration (high pH) and lower temperature, the factors are all favourable for the formation of oxyhaemoglobin.

In the tissues where low pO2, high pCO2, high H+ concentration (low pH) and higher temperature exist, the conditions are favourable for dissociation of oxygen from oxyhaemoglobin. Under these conditions, oxygen dissociation curve shifts away from the Y – axis (to the right). The effect of pCO2 and H+ concentration on the oxygen affinity of haemoglobin is called Bohr Effect (increase of carbondioxide in the blood and decrease in pH results in the reduction of the affinity of hemoglobin for oxygen).

II. Transport of Carbon Dioxide :
CO2 is transported in three ways.

i) In dissolved state :
7 percent of CO2 is carried in a dissolved state (physical solution) through plasma.
CO2 + H2O → H2CO3

ii) As carbamino compounds :
About 20 – 25 percent of CO2 combines directly with free amino group of the haemoglobin and forms carbamino-haemoglobin in a reversible manner.
Hb – NH2 + CO2 → Hb – NHCOO + H+

This binding of CO2 is related to the partial pressure of CO2. pO2 is a major factor which could affect this binding. When pCO2 is high and pO2 is low as in the tissues, binding of more carbon dioxide occurs. When pCO2 is low and pO2 is high as in the alveoli, dissociation of CO2Ā from carbamino – haemoglobin takes place, i.e., CO2 which is bound to haemoglobin from the tissues is delivered at the alveoli. Carbamino compounds are also formed by the union of CO2 with plasma proteins.

iii) As Bicarbonates :
About 70 percent of CO2 is transported as bicarbonate. RBCs contain a very high concentration of the enzyme, carbonic anhydrase and a minute quantity of the same is present in the plasma too. This enzyme facilitates the following reaction in both the directions.
TS Inter 2nd Year Zoology Study Material Chapter 1(b) Breathing and Exchange of Gases 5

At the tissues where partial pressure of CO2 is high due to catabolism, CO2 diffuses into the blood (RBC and Plasma) and forms carbonic acid which dissociates into HCO3 and H+. At the alveolar site where pCO2 is low, the reaction proceeds in the opposite direction leading to the formation of CO2 and water. Thus CO2 is mostly trapped as bicarbonate at the tissues and transported to the alveoli where it is released out as CO2. Every 100 mL of deoxygenated blood delivers approximately 4mL of CO2 to the alveolar air.

TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption

Telangana TSBIE TS Inter 2nd Year Zoology Study Material Lesson 1(a) Digestion and Absorption Textbook Questions and Answers.

TS Inter 2nd Year Zoology Study Material Lesson 1(a) Digestion and Absorption

Very Short Answer Type Questions

Question 1.
Give the dental formula of adult human [March 2015 (T.S.)]
Answer:
Dental formula of adult human being is = \(\frac{2123}{2123}\)
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 1

Question 2.
Bile juice contains no digestive enzymes, yet it is important for digestion. How?
Answer:
Bile salts of the bile help in the emulsification of fats (breakdown of fats into very small micelles). Bile also activates lipases of pancreatic juice (Steapsin) and intestinal lipases.

Question 3.
Describe the role of chymotrypsin. Name two other digestive enzymes of the same category and secreted by the same gland.
Answer:
Chymotrypsin acts upon proteins, proteoses and peptones to convert them into tripeptides and dipeptides.

Two other digestive enzymes of the same category and secreted by the same gland pancreas are a) trypsin b) carboxypeptidase.

Question 4.
What would happen if, HCl were not secreted in the stomach?
Answer:
HCI secreted by gastric glands in stomach provides the acidic pH (1.8) which is optimal for the action of pepsin. It also kills the microorganisms ingested along with food. Pepsinogen and prorenin are not activated if HCI were not secreted in the stomach.

Question 5.
Explain the terms thecodont and diphyodont dentitions.
Answer:

  1. Teeth of human beings are embedded in the sockets of the Jaw bones, hence called thecodont.
  2. Human beings form two sets or teeth during their life time, milk set and permanent adult teeth. This type of dentition is called diphyodont dentition.

TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption

Question 6.
What is auto catalysis? Give two examples.
Answer:
Trypsinogen is activated by the enzyme enterokinase into active trypsin which inturn can activate trypsinogen into trypsin it is called auto catalysis. Another such example is Pepsin.

Question 7.
What is chyme? [March 20191 May 2017 (A.P.)]
Answer:
The food is mixed thoroughly with the acidic gastric Juice of the stomach by the churning movements of its muscular wall and the product is called Chyme. (The semi digested paste like acidic food of stomach is called chyme).

Question 8.
Name the different types of salivary glands of man, and their locations in the human body. [March 2020]
Answer:
There are 3 pairs of salivary glands of Man.

  1. Parotid glands – present below the pinna and inner surface of cheeks.
  2. Sub maxillary glands-located at the angles of lower jaw.
  3. Sub lingual glands – present below the tongue.

Question 9.
Name different types of papillae present on the tongue of man. [March 2019, May 2017 (A.P.)]
Answer:
The different types of papillae present on the tongue of Man are a) fungi form b) filiform c) circumvallate papillae.

Question 10.
What is the hardest substance in the human body? What is its origin?
Answer:
The hardest substance in the body is enamel which is secreted by ameloblasts of ectodermal origin.

Question 11.
Name the structure of gut which is vestigial in human beings, but well developed in the herbivores and mention the type of tissue with which it is mostly formed.
Answer:
Structure of gut which is vestigeal in human beings is Vermiform appendix arises from the caecum, it is mostly formed from epithelial tissue.

Question 12.
Distinguish between deglutition and mastication.
Answer:

  1. Deglutition is swallowing of food facilitated by buccal cavity.
  2. Mastication is chewing. Teeth and tongue with the help of saliva masticate and mix up the food thoroughly.

TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption

Question 13.
Distinguish between diarrhoea and constipation.
Answer:
a) Diarrhoea :
The abnormal frequency of bowl movement and increased liquidity of the faecal discharge is known as diarrhoea. It results in loss of water (dehydration).

b) Constipation :
In constipation, the faeces are retained with in the rectum as it is hard due to low content of water and the movement of the bowel occurs irregularly.

Question 14.
Name two hormones secreted by the duodenal mucosa.
Answer:
Two hormones secreted by duodenal mucosa.

  1. Enterocrinin
  2. Secretin
  3. Cholecystokinin.

Question 15.
Distinguish between absorption and assimilation.
Answer:

  1. Absorption is the process by which the end products of digestion pass through the intestinal mucosa into blood or lymph.
  2. The absorbed substances finally reach the tissues where food materials become integral components of the living protoplasm and are used for the production of energy, growth and repair. This process is called assimilation.

Short Answer Type Questions

Question 1.
Draw a neat labelled diagram of L.S. of tooth. [Mar. ’20, 19, 18,17,14 (A.P.); May/June ’14]
Answer:
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 2

Question 2.
Describe the process of digestion of proteins in the stomach. [March 2015 (A.P.)]
Answer:
The gastric glands of stomach secrete acidic gastric juice. Gastric juice contains HCl, prorennin, pepsinogen and bicarbonates.

Proenzymes pepsinogen and prorennin, on exposure to HCl, are converted into the active enzymes, pepsin and rennin respectively.

Pepsin converts proteins into proteoses and peptones. Rennin is found in gastric juice of infants. It acts on milk protein casein in the presence of calcium ions and converts it into calcium paracaseinate (curd) and proteoses. Pepsin again acts on calcium para- caseinate and converts it into peptones. Certain other cells in the wall of stomach produce bicarbonate, a base to buffer the acidic contents of the stomach. Bicarbonates and mucus produced by stomach wall forms a physical barrier to prevent HCl from damaging the wall of stomach.
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 3

Question 3.
Explain the role of Pancreatic Juice in the digestion of proteins.
Answer:
Pancreatic juice contains sodium bicarbonate, trypsinogen, chymotrypsinogen, carboxypeptidase, pancreatic lipase (steapsin), pancreatic amylase and nucleases such as DNA ase and RNA ase.

Trypsinogen is activated by an enzyme enterokinase into active trypsin which in turn activates the other enzymes in the pancreatic juice. Trypsin itself can similarly activate trypsinogen into trypsin (autocatalysis).
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 4
Proteolytic enzymes of the pancreatic juice act upon proteins, proteoses and peptones when they reach intestine.
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 5
Thus the end products of digestion of proteins namely amino acids are formed in the small intestine.

TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption

Question 4.
How are polysaccharides and disaccharides digested?
Answer:
Polysaccharides are nothing but carbohydrates. Carbohydrates in the chyme are hydrolysed by the pancreatic amylase into disaccharides. Intestinal disaccharidases act on the disaccharides and convert them into monosaccharides like Glucose etc.
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 6

Question 5.
If, you take butter in your food, how does it get digested and absorbed in the body? Explain.
Answer:

  1. Butter is a content of macromolecules and is fat or lipid.
  2. Bile salts of the bile help in breaking down of large fat molecules into very small micelles. This process is called Emulsification. They move into intestinal mucosal cells.
  3. These micelles are reformed into very small protein coated fat globules called chylomicrons which are transported into the lacteals in the villi by exocytosis.
  4. Bile also activates lipases of pancreatic juice (steapsin) and intestinal lipases. These lipases act on emulsified fats and convert them into fatty acids and glycerols.
    TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 7

Question 6.
What are the functions of liver? [May 2017 (A.P.); March 2015 (T.S.)]
Answer:
Functions of the liver :
Liver performs a variety of functions such as synthesis, storage and secretion of various substances. There are as follows :

  1. Liver secretes bile juice. It does not contain enzymes, but it contains bile salts such as glycocholates and taurocholates of sodium and potassium and ‘bile pigments’ the bilirubin and biliverdin.
  2. Liver plays the ‘key role’ in carbohydrate metabolism (glycogenesis, glycogenolysis, gluconeogenesis and lipogenesis).
  3. Liver also plays a role in lipid metabolism (synthesis of cholesterol and production of triglycerides).
  4. Deamination of proteins (removal of NH2 group from the amino acids) and conversion of ammonia into to urea – via the ornithine cycle).
  5. The lactic acid formed during anaerobic muscle contraction is converted into glycogen (gluconeogenesis) in the liver by Cori cycle.
  6. Liver is the chief organ of detoxification of toxic substances that enter the gut along with food.
  7. Liver acts as thermoregulatory organ (like skeletal muscle, liver too takes part in thermogenesjs as it has high glucose at its disposal).
  8. Liver acts as a haemopoietic organ in the foetus and erythroclastic organ in the adult.
  9. The liver synthesizes the plasma proteins such as albumins, globulins, blood clotting factors such as fibrinogen, prothrombin, etc., and the anticoagulant, called heparin.
  10. Kupffer’s cells/ Kupffer cells are the large phagocytic cells which remove unwanted substances and microbes that attack the liver by phagocytosis. They are present in the sinusoids that lie in between hepatic cords and they are also called hepatic macrophages.

Long Answer Type Questions

Question 1.
Describe the physiology of digestion of various types of food in the human digestive system.
Answer:
Physiology of digestion :
Digestion is the process of conversion of complex non – diffusible food substances into simple diffusible forms. The process of digestion is accomplished by mechanical (cutting and chewing of food by teeth and churning of food by peristalsis) and chemical (enzymatic reactions by hydrolysing enzymes) processes.
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 8

i) Digestion in the buccal cavity :
Buccal cavity performs two major functions, mastication of food and facilitation of swallowing (deglutition). Teeth and tongue with the help of saliva masticate and mix up the food thoroughly. Mucus in saliva helps in lubricating and adhering the masticated food particles into a bolus. The saliva secreted into oral cavity contains electrolytes such as Na+, K+, Cl, HCO3 and enzymes, such as salivary amylase (ptyalin) and lysozyme. The chemical process of digestion is initiated in the oral cavity (buccal cavity) by the hydrolytic action of carbohydrate (starch) splitting enzyme, the salivary amylase. About 30% of starch is hydrolyzed here into a disaccharide called maltose by the enzyme ptyalin. Lysozyme present in the saliva acts as an antibacterial agent that prevents infections.

ii) Digestion in the stomach :
The stomach stores food for 4-5 hours. The food is mixed thoroughly with the acidic gastric juice of the stomach by the churning movements of its muscular wall and the product is called chyme. The mucus and bicarbonates present in the gastric juice play an important role in the lubrication and protection of the mucosal epithelium from ‘excoriation’ by the highly concentrated hydrochloric acid. HCl provides the acidic pH (1.8) which is optimal for the action of pepsin. It also kills the microorganisms ingested along with food. The proenzymes of gastric juice, the pepsinogen and prorennin, on exposure to hydrochloric acid are converted into the active enzymes pepsin and rennin respectively. Pepsin converts proteins into proteoses and peptones. Rennin is a proteolytic enzyme found in the gastric juice of infants.

It acts on the milk protein, the casein in the presence of calcium ions and converts it into calcium paracaseinate (curdling of milk) and proteoses. Pepsin acts on calcium paracaseinate and converts it into peptones. Proteoses are a group of compounds formed during protein digestion and they are more complex than peptones. Certain other cells in the wall of the stomach produce bicarbonate, a base, to buffer the acidic contents of the stomach. They also prevent too much acidity in the stomach. The mucus produced by the wall of the stomach forms a physical barrier to prevent HCl from damaging the wall of the stomach.
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 9

iii) Digestion in the small intestine :
Various types of movements are generated by the muscularis external layer of the small intestine. These movements help in thorough mixing up of the food with bile, pancreatic juice and intestinal juice in the intestine and thereby facilitate digestion. The mucus along with the bicarbonates from pancreas protects the intestinal mucosa from the acidic medium and provides an alkaline medium (pH 7.8) for enzymatic activities. The duodenal cells of the proximal part also produce large amounts of bicarbonate to completely neutralize any gastric acid that passes further down into the digestive tract. All the enzymes of the pancreatic juice and succus entericus (mentioned above) act only in alkaline medium.

i) Digestion of proteins :
Trypsinogen, chymotrypsinogen and procarboxy peptidases are inactive enzymes. Trypsinogen is activated by the enzyme, enterokinase, secreted by the intestinal mucosa into active trypsin, which in turn activates the other enzymes in the pancreatic juice. Trypsin itself can similarly activate trypsinogen into trypsin (autocatalysis).
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 10

Proteins, proteoses and peptones (partly hydrolysed proteins) in the chyme, reaching the intestine are acted upon by the proteolytic enzymes of the pancreatic juice and intestinal juice as shown below :
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 11

Thus the end products of digestion of proteins namely amino acids are formed in the small intestine.

ii) Digestion of fats:
Bile salts of the bile help in the emulsification of fats i.e., break down of fats into very small micelles. Bile also activates lipases of pancreatic juice (steapsin) and intestinal lipases. These lipases act on emulsified fats and convert them into fatty acids and glycerols.
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 12

iii) Digestion of Carbohydrates :
Carbohydrates in the chyme are hydrolysed by the pancreatic amylase into disaccharides. Intestinal disaccharidases act on the ‘disaccharides’ and convert them into monosaccharides.
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 13

iv) Digestion of nucleic acids :
Nucleases (DNAase, RNAase) of the pancreatic juice act on the nucleic acids to form nucleotides and nucleosides. Nucleotidases and nucleosidases of the intestinal juice convert the nucleotides and nucleosides into pentose sugars and nitrogen bases.
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 14

Question 2.
Explain the digestive system of man with neat labelled diagram.
Answer:
Digestive System :
Human digestive system consists of the alimentary canal and the associated glands.

Alimentary canal / digestive tract :
The alimentary canal of man begins with the anterior opening, the mouth and ends with the posterior opening, the anus. Parts of the alimentary canal between the mouth and the anus include buccal cavity, pharynx, oesophagus, stomach, small intestine and the large intestine in the given order.
TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 15

I. Mouth and Buccal (oral) cavity :
The mouth, bordered by the movable upper and lower lips (labia), leads into the buccal or oral cavity. The palate separates the ventral buccal cavity from the dorsal nasal chamber and facilitates chewing and breathing simultaneously. The anterior bony hard palate is lined by palatine rugae. The posterior soft palate that hangs down into the pharynx is called uvula. The jawbones bear four kinds of teeth and a tongue occurs at the base of the buccal cavity.

i) Teeth :
These are ecto-mesodermal in origin. Teeth of human beings are embedded in the sockets of the jaw bones – hence called thecodont. Majority of mammals including human beings form two sets of teeth during their life time, a set of temporary/milk or deciduous teeth replaced by a set of permanent or adult teeth. This type of dentition is called diphyodont dentition. An adult human has 32 permanent teeth, which are of four different types namely, incisors (I), canines (C), premolars (PM), and molars (M), and such a type of dentition is called heterodont dentition. The arrangement of different types of teeth in each half of both the jaws in the order I, C, PM, M is represented by the dental formula. In adult humans it is \(\frac{2123}{2123}\) = 32. The dental formula of the ‘milk dentition’ of a baby is \(\frac{2102}{2102}\) = 20 teeth. The third molar teeth appear very late (usually at about 21 years of age) and are called wisdom teeth. Incisors, the ‘chisel shaped’ teeth are useful in cutting, canines, the dagger like teeth help in tearing, premolars and molars, the cheekteeth, help in grinding the food.

TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption 16
ii) Tongue :
It is a freely movable, muscular sense organ, attached to the floor of the oral cavity by a fold of tissue called frenulum. The upper surface of the tongue has small projections called papillae, some of which bear taste buds. In humans the tongue bears 3 types of papillae namely 1. fungi form (at the anterior margin and tip of tongue), 2. filiform (on the surface of the tongue) and 3. circumvallate papillae (on the posterior surface / base of the tongue). The tongue acts as ‘universal tooth brush’, and helps in mixing saliva with food, taste detection, deglutition and speaking.

II. Pharynx :
The oral cavity leads into a short pharynx which serves as a common passage for food and air. It is divided into nasopharynx (lies above the soft palate), oropharynx (the middle part) and laryngopharynx (the lower part) by the soft palate. Oesophagus and trachea open into the laryngopharynx. The trachea opens into the laryngopharynx through the glottis. A cartilaginous flap called epiglottis prevents the entry of food into glottis during swallowing. Pharynx possesses voluntary muscles to assist in swallowing. Tonsils (lymphoid tissues) present in the pharynx, include i) pharyngeal tonsil or adenoids, ii) a pair of palatine tonsils and iii) a pair of lingual tonsils.

III. Oesophagus :
The oesophagus is a thin long tube which extends posteriorly, passing through the neck, thorax and diaphragm and it finally leads into the stomach. A muscular sphincter (gastro – esophageal / cardiac sphincter) regulates the opening of the oesophagus into the stomach.

IV. Stomach :
The stomach is a wide, J – shaped, distensible muscular bag like structure, located in the upper left portion of the abdominal cavity just below the diaphragm. It has three major parts, an anterior cardiac portion into which the oesophagus opens, a middle large fundic region (main body) and a posterior pyloric portion which opens into the first part of the small intestine through the pyloric aperture which is guarded by the pyloric sphincter.

V. Small intestine :
The small intestine is the longest part of the alimentary canal. It is distinguished serially into three regions namely proximal duodenum, middle long coiled jejunum and distal highly coiled ileum. Duodenum receives the hepato – pancreatic duct. Ileum opens into the large intestine.

TS Inter 2nd Year Zoology Study Material Chapter 1(a) Digestion and Absorption

VI. Large Intestine :
It consists of caecum/colon and rectum. Caecum is a small blind sac which hosts some symbiotic microorganisms. A narrow finger – like tubular projection, the vermiform appendix (abdominal tonsil) which is a vestigial organ, arises from the caecum. The caecum opens into the colon which is divided into – an ascending, a transverse, a descending parts and a sigmoid colon that continues behind into the rectum. Colon shows the external bulged out pouches called haustra. Rectum is a small dilated sac which leads into anal canal that opens out through the anus.

It is guarded by an internal anal sphincter formed by ‘smooth muscle’ and external anal sphincter formed by a ring of voluntary, striped muscle. There is no significant digestive activity in the large intestine. It is concerned with the absorption of some water, minerals and certain drugs. It secretes mucus which helps in keeping the undigested particles together and lubricating its passage to the exterior.

Digestive glands :
The digestive glands present in the wall of the alimentary canal are gastric glands, Brunner’s glands, and crypts of Lieberkuhn. The salivary glands, liver and pancreas are the digestive glands associated with the gut (extra alimentary canal glands).

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Telangana TSBIEĀ TS Inter 2nd Year Botany Study Material 14th Lesson Microbes in Human Welfare Textbook Questions and Answers.

TS Inter 2nd Year Botany Study Material 14th Lesson Microbes in Human Welfare

Very Short Answer Type Questions

Question 1.
Why does ‘Swiss cheese’ have big holes? Name the bacteria responsible for it. [Mar. 2020, 18; May 14]
Answer:

  1. Large holes in ‘Swiss cheese’ are due to the production of a large amount of CO2 by a Bacterium.
  2. Propionibacterium sharmanii is responsible for it.

Question 2.
What are fermentors? [May 17; Mar. 14]
Answer:

  1. Very large vessels that are used to grow microbes for production of valuable products on an industrial scale.
  2. Beverages like wine, beer, whisky, brandy and rum are produced through fermentation of malted careals and fruit juices by yeast.

Question 3.
Name a microbe used for statin production. How do statins lower blood cholesterol level?
Answer:

  1. Statins are produced by the yeast, Monascus purpureus.
  2. The act by competitively inhibiting the enzyme responsible for the synthesis of cholesterol.

Question 4.
Why do we prefer to call secondary waste water treatment as biological treatment?
Answer:

  1. During secondary waste water treatment, the aeration allows vigorous growth of useful aerobic microbes into floes and reduces BOD (Biochemical Oxygen Demand) of the effluent.
  2. The microbes consume the major part of the organic matter in the effluent and hence secondary waste water treatment is called Biological treatment.

Question 5.
What is Nucleopolyhedrovirus is being used for nowadays?
Answer:

  1. Nucleopolyhedrovirus are Baculoviruses, used as biocontrol agents.
  2. They attack insect and other arthropods. They are species-specific,’narrow spectrum insecticides and have no negative impact on plants, birds, mammals, fish and even non-target insects.

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Question 6.
How has the discovery of antibiotics helped mankind in the field of medicine?
Answer:

  1. Penicillin was extensively used to treat American soldiers wounded in World War – II.
  2. Antibiotics have greatly improved our capacity to treat dreadly diseases like plague, diphtheria, whooping cough and leprosy.

Question 7.
Why is distillation required for producing certain alcoholic drinks?
Answer:

  1. Strong alcoholic drinks such as whisky, brandy and rum with a higher concentration of ethanol are produced by the distillation of the fermented broth.
  2. Because, yeasts poison themselves to death when the concentration of alcohol reaches about 13 percent.

Question 8.
Write the most important characteristic that Aspergillus niger, Clostridium butylicum and Lactobacillus share.
Answer:

  1. These are organic acid producers.
  2. Aspergillus niger (a fungus) produce citric acid, Clostridium butylicum (a bacterium) produce butyric, and acid Lactobacillus share (a bacterium) produce lactic acid.

Question 9.
Give any two microbes that are useful in biotechnology. [March 2014]
Answer:

  1. Streptiococcus to produce stroptokinase, a clot buster for removing clots from the blood vessels of patients with myocardial infection.
  2. Trichoderma Polysporum to produce cyclosporin – A, an immuno oppressive agent in organ transplant patients.

Question 10.
Name any two genetically modified crops.
Answer:

  1. Bt-cotton
  2. Bt-brinjal.

Question 11.
Why are blue green algae not popular as biofertilisers?
Answer:

  1. Blue green algae (cyanobacteria) mostly live in aquatic environment and are commercialized during recent days.
  2. Hence, BGA are used as biofertilizers in paddy fields with water for most of the crop period.

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Question 12.
Which species of Penicillium produces Roquefort cheese?
Answer:

  1. Penicillium roquefort is used for ripening the Roquefort cheese.
  2. This gives a particular flavour to cheese.

Question 13.
Name any two industrially important enzymes. [Mar. 2019, 17]
Answer:

  1. Pectinases and proteases used to clarify bottled juices.
  2. Streptokinase, a clot buster for removing clots from the blood vessels.

Question 14.
Name an immunosuppressive agent.
Answer:

  1. Cyclosporin A is used as immunosuppressive agent.
  2. It is produced from a fungus, trichoderma polysporum

Question 15.
Give an example of a rod shaped virus.
Answer:
Tobacco mosaic virus is rod shaped virus.

Question 16.
What is the group of bacteria found in both the rumen of cattle and sludge of sewage treatment?
Answer:
Methanogens – Methanbacterium.

Question 17.
Why are cyanobacteria considered useful in paddy fields?
Answer:

  1. Cyanobacteria (Blue Green Algae) are autotrophic microbes, they require aquatic environment.
  2. In paddy fields water is available for most of the time, hence BGA are considered as useful Nitrogen fixers that add organic matter to the soil and increase soil fertility.

Question 18.
In which food would you find lactic acid bacteria? Name the bacterium.
Answer:

  1. Lactic acid bacteria grow in milk and convert it into curd.
  2. Bacteria name is Lactobacillus.

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Question 19.
Name any two fungi which are used in the production of antibiotics.
Answer:

  1. Penicillin notatum – Penicillin
  2. Penicillin griseoflavus – Griepseofulvin.

Question 20.
Name the scientists who were credited for showing the role of penicillin as an antibiotic.
Answer:

  1. Alexander Fleming discovered penicillin, the first antibiotic from pencillium notatum.
  2. Ernest Chain and Howard Florey used penicillin to treat American soldiers wounded in World War-II.

Short Answer Type Questions

Question 1.
Why are the floes important in the biological treatment of waste water?
Answer:

  1. The primary effluent is passed into large aeration tanks where it is constantly agitated mechanically and air is pumped into it.
  2. This allows vigorous growth of useful aerobic microbes into floes.
  3. Floes are masses of bacteria associated with fungal filaments to form mesh like structures.
  4. While growing, these microbes consume the major part of the organic matter in the effluent.
  5. This significantly reduces the BOD (Biochemical Oxygen Demand) of the effluent.
  6. When BOD of sewage is reduced, the effluent is passed into a settling tank, where the floes are allowed to form the activated sludge.

Question 2.
How is Bacillus thuringiensis helpful in controlling insect pests?
Answer:

  • Bacillus thuringiensis often written as Bt.
  • Dried spores of Bt are used to control butterfly Caterpillars.
  • Insect larva, after eating these are killed by the toxin, released in their gut.
  • The bacterial disease will kill the caterpillars but leave other insects unharmed.
  • Bacillus thuringiensis toxin genes have been introduced into plants to provide resistance to pests.

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Question 3.
How do mycorrhizal fungi help the plants harbouring them?
Answer:
The symbiotic association between fungi members and roots of vascular plants is called mycorrhizae.

Many members of the genus Glomus forms mycorrhiza. The fungal symbiont in these associations facilitates absorption of phosphorus by the plant from the soil.

Plants having such associations shows other benefits also such as resistance to root-borne pathogens, tolerance to salinity and drought and over all increase in plant growth and development.

Question 4.
How was penicillin discovered?
Answer:
Alexander Fleming while working on Staphylococci bacteria, once observed a mould growing in one of his unwashed culture plates around which staphylococci could not grow.

He found out that it was due to a chemical produced by the mould and he named it as penicillin after the mould penicillium notatum. However, its full potential as an effective antibiotic was established only much later by Ernest Chain and Howard Florey. Fleming, Chain and Florey were awarded Nobel Prize in 1945 for this discovery.

Question 5.
How do bioactive molecules of fungal origin help in restoring good health of humans?
Answer:

  1. Bioactive molecule, cyclosporin A, is used as in immunosuppressive agent in organ- transplant patients. It is produced by fungus Trichoderma polysporum.
  2. Statin is produced by the yeast Monascus purpurens. It has been commercialised as blood-cholesterol lowering agents. They act by competitively inhibiting the enzyme responsible for the synthesis of cholesterol.

Question 6.
What is the chemical nature of biogas? Explain the process of biogas production.
Answer:
Biogas comprises methane (CH4), carbondioxide (CO2), traces of hydrogen sulphide (H2S) and moisture. Biogas is generated by the decomposition of excreta or dung of cattle (commonly called as gobar), domestic waste material, industrial and agriculture sewage due to the activity of anaerobic bacteria present in them.

Biogas formation from activated sludge :

  • A small part of activated sludge is pumped into the aeration tank to serve as inoculum.
  • In aeration tank anaerobic bacteria called methnogens digest the bacteria and fungi of the sludge.
  • During the digestion the bacteria produce a mixture of gases like C02, CH3 and H2S which forms biogas.

Biogas formation from dung :

  1. The biogas plant consists of a concrete tank in which bio wastes are collected and a slurry of a dung is fed.
  2. A floating cover is placed over the slurry, which keeps on raising as the gas is produced in the tank due to the microbial activity.
  3. The biogas plant has an outlet which is connected to a pipe to supply biogas to near by houses.

Question 7.
Which bacterium has been used as a clot buster? What is its mode of action?
Answer:
Bacterium Streptococcus has been used on a clot buster.

Steptokinase, produced by the bacterium streptococcus and modified by genetic engineering is used as a clot buster for removing clots from the blood vessels of patients who have undergone mycocardial infection leading to heart attack.

Question 8.
What are biofertilisers? Give two examples and discuss their role as biofertilisers.
Answer:
The organisms that enrich the nutrient quality of the soil are called biofertilisers. The main sources of biofertilisers are bacteria, fungi and cyanobacteria.

  1. Rizobium bacteria present as a symbiotic association in the nodular roots of leguminous plants. They fix atmospheric nitrogen into organic forms, which are used by the plant as a nutrient.
  2. In paddy fields cyanobacteria serve as an important fertiliser. They fix atmospheric nitrogen. They also add organic matter to the soil and increase its fertility.
    Eg : Anabaena, Nostoc, Oscillatoria etc.

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Question 9.
What role do enzymes play in detergents that we use for washing clothes? Give examples.
Answer:
Microbes are used for producing enzymes. Enzyme Lipases are used in detergents formulations and are helpful in removing oily stains from laundry Example is Lipases.

Long Answer Type Questions

Question 1.
a) What would happen if a large volume of untreated sewage is discharged into a river?
b) In what way is anaerobic sludge digestion important in sewage treatments?
Answer:
a) The untreated sewage discharged directly into rivers, leading to their pollution and an increase in water born diseases.

b) Treatment of sewage involves two steps. 1) Primary treatment 2) Secondary treatment

Primary treatment :
It is a physical process of removal of small and large particles through filtration and sedimentation.

  • The sewage is allowed to go into the primary setting tank, where the suspended material settle down to form primary sludge.
  • The effluent is taken for secondary treatment. The anaerobic sludge digestion is important in secondary sewage treatment.

Secondary sewage treatment:

  • It is a biological process that employs the heterotrophic bacteria naturally present in the sewage.
    The effluent from the primary treatment is passed into large aeration tanks, where it is constantly agitated and air is pumped in it.
  • This allows the rapid growth of aerobic bacteria into floes, which consume the organic matter of sewage and reduce the BOD.
  • The effluent is passed into a settling tank, where the floes are allowed to sediment forming the activated sludge.
  • A small part of the activated sludge is pumped back into aeration tank as inoculum.
  • The remaining major part of the sludge is pumped into sludge digestors, where the anaerobic bacteria digest the organic matter and produce a mixture of gases such as methane, hydrogen sulphide and CO2. These gases form biogas which can be used as a source of energy as it is. inflammable.

Question 2.
Which type of food would have lactic acid bacteria? Discuss their useful application.
Answer:

  1. Curd is formed by adding lactobacillus bacteria as Lactic Acid Bacteria (LAB) in milk.
  2. A small amount of curd is added to the fresh milk as starter which contains millions of LAB.
  3. LAB at suitable temperature multiply and convert milk into curd which also increase nutritional quality by increasing vitamin B12.
  4. During growth, LAB produce acids that coagulate and partially digest the milk proteins.
  5. LAB also check disease-causing microbes in the stomach.
  6. The use of such friendly bacteria for therapeutic purposes and for the betterment of human health has led to the concept of Probiotics.
  7. Lactic acid bacteria is also used in bakery products, beverages, meat products, confectionery, dairy products etc.

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Question 3.
Write a brief essay on Microbes as biocontrol agents.
Answer:
Biocontrol can be defined as the use of biological methods of controllingthe plant diseases and pests.

  1. The use of insecticides and pesticides although useful, but are toxic and extremely harmful to humans, animals and polluting our natural resources.
  2. Agriculture relies in natural control of pests i.e., natural predation rather than introduced chemicals.
  3. Farmers are in view that the eradication of the creatures that are often described as pests is undesirable because without them beneficial predatory and parasitic insects would not survive.
  4. Some approaches for having biocontrol agents.
    i) Familiarity with various life forms inhabiting the field.
    ii) Understanding of their life cycles, patterns of feeding and habitat of predators and pests.

5) Examples of biocontrol agents are
i) The lady bird and dragonflies are useful to get rid of aphids and mosquitoes, respectively.
ii) The bacteria Bacillus thuringiensis (Bt) are used to control butterfly, catterpillars.

  • Dried spores of Bt are mixed with water and sprayed onto vulnerble plants such as brassicas and fruit trees, where these are eaten by the insect larvae.
  • In the gut of the larvae, the toxin is released and the larvae get killed.
  • The bacterial disease will kill the catterpillars but leave other insects unharmed.
  • B thuringiensis toxin genes are introduced into plants by genetic engineering. Such plants are resistant to attack by insect pests. For example Bt. Cotton.

iii) Baculoviruses are pathogens that attack insects and other arthropods.

  • Majority of baculoviruses used as biological control agents belong to the genus Nucleopoly – hedrovirus.
  • These are species, specific, narrow spectrum insecticides.
  • They do not harm plants, mammals, birds, fish and other nontarget insects.
  • Baculoviruses are beneficial in Integrated Pest Management (IPM) programme, in which beneficial insects are conserved.

Question 4.
What is organic farming? Discuss the role of plant microbes in organic farming with examples.
Answer:
Organic farming is a form of agriculture that works in hormony with nature rather than against it. It is done by using only natural and organic materials. Organic farming refers to biofertilizers and biopesticides.

The role of plant microbes in organic farming :
Microbes are biofertilizers enrich the nutrients (nitrogen, phosphorus, etc) quality of the soil.
i) The main source of biofertilizers are bacteria, fungi and cyanobacteria.

ii) Bacteria as biofertilizer:
a) The nodules on the roots of leguminous plants are formed by the symbiotic association of Rhizobium’bacteria.
b) These bacteria fix atmospheric nitrogen into organic forms, which is used by the plants as nutrient.
c) Other bacteria, such as Azospirillum and Azatobacter fix atmospheric nitrogen while free living in Jhe soil. They enrich the nitrogen content of the soil.

iii) Fungi as biofertilizers:
a) Fungi form symbiotic association with plants (Mycorrhiza).
b) The fungal hyphae absorb phosphorus from soil and passes into the plant.
c) Mycorrhiza shows the following benefits.

  • Resistance to root borne pathogens.
  • Tolerance to salinity and drought.
  • Overall increase in plant growth and development.

iv) Cyanobacteria as biofertilizers :
a) These are autotrophic microbes, many of them fix atmospheric nitrogen.
b) Examples of cyanobacteria are Anabaena, Nostoc, Oscillatoria etc.
c) Blue-green algae also add organic matter to the soil and increase its fertility.

v) A number of biofertilizers are available commercially in the market. Farmers use these in fields and replenish soil nutrients and to reduce dependence on chemical fertilizers.

Intext Question Answers

Question 1.
Bacteria cannot be seen with the naked eye, but these can be seen with the help of a microscope. If you have to carry a sample from your home to your biology laboratory to demonstrate the presence of microbes under a microscope. Which sample would you carry and why?
Answer:
Curd can be used as a sample for the study of microbes. Curd contains numerous lactic acid bacteria (LAB) or lactobacillus. These bacteria produce acids that coagulate and digest milk proteins. A small drop of curd contains millions of bacteria which can be easily observed under a microscope.

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Question 2.
Give examples to prove that microbes release gases during metabolism.
Answer:
The examples of bacteria that release gases during metabolism are :
a) Bacteria and fungi carry out the process of fermentation and during this process, they release carbon dioxide. Fermentation is the process of converting a complex organic substance into simpler substance with the action of bacteria or yeast. Fermentation of sugar produces alcohol with the release of carbon dioxide and very little energy.
b) The dough used for making idli and dosa gives a puffed appearence. This is because of the action of bacteria which releases carbon dioxide. This CO2 released from the dough gets trapped in the dough thereby giving it a puffed appearance.

Question 3.
Name the states involved in Ganga action plan.
Answer:
The states involved are Bihar, Uttar Pradesh, Uttarakhand.

Question 4.
Name some traditional Indian foods made of wheat, rice and bengal gram (or their products). Which of these foods involve the use of microbes?
Answer:
Wheat product: Bread, Cake etc.
Rice product: Idli, dosa.
Bengal gram product: Dhokla, Khandvi.

Question 5.
In which way have microbes played a major role in controlling diseases caused by harmful bacteria?
Answer:
Several microorganisms are used for preparing medicines. Antibiotics arfe (medicines produced by certain microorganisms to kill other (disease – causing) microorgansims. These medicines are commonly obtained from bacteria and fungi. They either kill or stop the growth of disease causing microorganisms Streptomycin, tetracycline and penicillin are common antibiotics.

Penicillin notatum produces chemical penicillin which checks the growth of staphylococci bacteria in the body. Antibiotics are designed to destroy bacteria by weakening their cell walls. Asa result of this weakening, certain immune cells such as the white blood cells enters the bacterial cell and cause cell lysis. Cell lysis is the process of destroying cells such as blood cells and bacteria.

Question 6.
Do you think microbes can also be used as a source of energy. If yes, how?
Answer:
Yes, microbes can be used as a source of energy. Bacteria such as Methane bacterium is used for the generation of gobar gas or biogas. The generation of biogas is an anaerobic process in a biogas plant which consists of a concrete tank (10-15 feet deep) with sufficient outlets and inlets. The dung is mixed with water to form the slurry and thrown into the tank.

The digester of the tank is filled with numerous anaerobic methane producing bacteria, which produce biogas from the slurry. Biogas can be removed through the pipe which is then used as a source of energy while the spent slurry is removed from outlet and is used as a fertilizer.

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Question 7.
Microbes can be used to decrease the use of chemical fertilizers and pesticides. Explain how this can be accomplished.
Answer:
Microbes play an important role in organic farming which is done without the use of chemical fertilizers and pesticides. Biofertilizers are living organisms, which can help to increase the fertility of soil. It involves the selection of beneficial microorganisms that help in improving plant growth through the supply of plant nutrients. Biofertilizers are introduced in seeds, roots or soil to mobilize the availability of nutrients. Thus they are extremely beneficial in enriching the soil with organic nutrients.

Many species of bacteria and cyanobacteria have the ability to fix free atmospheric nitrogen. Rhizobium is a symbiotic bacteria found in the root nodules of leguminous plants. Azospirillum and Azatobacter are free living nitrogen fixing bacteria wheareas Anabena, Nostoc, Oscillitoria are examples of Nitrogen- fixing cyanobacteria. Biofertilizers are cost effective and eco-friendly. Microbes can also act as bio pesticides to control insect pests in plants. An example of bio-pesticides is Bacillus thuringiensis, which produces a toxin that kills the insect pests.

Dried bacterial spores are mixed in water and sprayed in agricultural fields. When larvae of insects feed on crops, these bacterial spores enter the gut of larvae and release toxins, there by it, similarly Trichoderma are free living fungi. They live in the roots of higher plants and protect them from various pathogens. Baculoviruses is another biopesticide that is used as a biological control agent against insects aod other arthropods.

Question 8.
Three water samples namely river water, untreated sewage water and secondary effluent discharged from a sewage treatment plant were subjected to BOD test. The samples were labelled A,B and C; but the laboratory attendant did not note which was which. The BOD values of the three samples A,B and C were recorded as 20mg/L, 8mg/L and 400 gm/L respectively. Which sample of the water is most polluted? Can you assign the correct label to each assuming the river water is relatively clean?
Answer:
Biological Oxygen Demand (BOD) is the method of determining the amount of oxygen required by micro-organisms to decompose the waste present in the water supply. If the quantity of organic wastes in the water supply is high, then the number of decomposing bacteria present in the water will also be high. As a result, the BOD value will increase. Therefore it can be concluded that if the water supply is more polluted, then it will have a higher BOD value out of the above three samples, sample C is the most polluted since it has the maximum BOD value of 400mg/L.

After untreated sewage water, secondary effluent discharge from a sewage treated plant is most polluted. Thus sample A is secondary effluent discharge from a sewage treatment plant and has the BOD value of 20mg/L. While sample B is river water and has the BOD value of 8mg/L.

LabelBOD valueSample
A20 mg/LSecondary effluent discharge from a sewage treatment plant.
B8mg/LRiver water
C400 mg/LUntreated sewage water

Question 9.
Name the microbes from which Cyclosporin A (an immunosuppressive drug) and statins (blood cholesterol lowering agents) are obtained.
Answer:

DrugFunctionMicrobe
1. Cyclosporine -AImmunosuppressive drugTrichoderma polysporum
2. StatinBlood cholesterol lowering agentMonascus purpurens

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Question 10.
Find out the role of microbes in the following and discuss it with your teacher, (a) Single Cell Protein (SCP). (b) Soil.
Answer:
a) Single cell protein (SCP) is a cell protein obtained from certain microbes, which form an alternated source of proteins in animal feeds. The microbes involved in the preparation of single cell proteins are algae, yeast or bacteria. These microbes are grown on an industrial scale to obtain the desired protein. For example Spirulina can be grown on waste material obtained from molasses, sewage, and animal manures. It serves as a rich supplement of dietary nutrients such as proteins, carbohydrate, fats, minerals and vitamins. Similarly microorganisms such as Methylophilus and Methylotrophus have a large rate of biomass production. Their growth can produce a large amount of proteins.

b) Soil microbes play an important role in maintaining soil fertility. They help in the formation of nutrient rich humus by the process of decomposition. Many species of bacteria and cyanobacteria have the ability to fix atmospheric nitrogen into usuable form. Rhizobium is a symbiotic bacteria found in the root nodules of leguminous plants. Azospirillium and Azotobacter are free living nitrogen fixing bacteria whereas Anaebena, Nostoc and Oscillitoria are examples of nitrogen fixing cyanobacteria.

Question 11.
Arrange the following in the decreasing order (most important first) of their importance, for the welfare of human society. Give reasons for your answer. Biogas, Citric acid, Penicillin and Curd.
Answer:
The order of arrangement of products according to their decreasing importance is Penicillin – Biogas – Citric acid – Curd. Penicillin is the most important product for the welfare of human society. It is an antibiotic, which is used for controlling various bacterial diseases. The second most important product is biogas. It is an eco-friendly source of energy. The next important product is citric acid which is used as a food preservative. The least important product is curd a food item obtained by the action of lactobacillus bacteria on milk. Hence the products in the decreasing order of their importance are as follows Penicillin – Biogas – Citric acid – Curd.

Question 12.
What is sewage? In which way can sewage be harmful to us?
Answer:
Sewage is the municipal waste matter that is carried away in sewers and drains. It includes both liquid and solid wastes, rich in organic matter and microbes. May of these microbes are pathogenic and can cause several waste borne diseases. Sewage water is the major cause of polluting drinking water. Hence it is essential that sewage water is properly collected, treated and disposed.

TS Inter 2nd Year Botany Study Material Chapter 14 Microbes in Human Welfare

Question 13.
What is the key difference between primary and secondary sewage treatment?
Answer:

Primary sewage treatmentSecondary sewage treatment
1) It is a mechanical process involving the removal of coarse solid materials.1) It is a biological process involving the action of microbes.
2) It is inexpensive and relatively less complicated.2) It is very expensive and complicated process.

TS Inter 2nd Year Botany Study Material Chapter 13 Strategies for Enhancement in Food Production

Telangana TSBIEĀ TS Inter 2nd Year Botany Study Material 13th Lesson Strategies for Enhancement in Food Production Textbook Questions and Answers.

TS Inter 2nd Year Botany Study Material 13th Lesson Strategies for Enhancement in Food Production

Very Short Answer Type Questions

Question 1.
What is meant by ā€˜hidden hunger’?
Answer:

  1. About 3 billion people over the globe are suffering from deficiencies of micro nutrients, protein and vitamins. This situation is said to be ‘Hidden hunger’.
  2. More than 840 million people in the world do not have adequate food to meet their daily food and nutritional requirements.

Question 2.
Name two semi-dwarf varieties of rice developed in India. [Mar. 2020]
Answer:

  1. Jaya and Ratna, are two better yielding semi – dwarf varieties of rice developed in India.
  2. They are derivatives of semi – dwarf varieties derived from crossing IR – 8 with TN – 1.

Question 3.
Give two examples of wheat varieties introduced in India, which are high yielding and disease resistant. [March 2018]
Answer:

  1. Sonalika and Kalyan Sona,
  2. They were introduced in 1963, all over the wheat growing belt in India.

Question 4.
Give two examples of fungi used in SCP production. [March 2019, Mar. ’17; May ’17]
Answer:

  1. Candida utilis (Torula yeast)
  2. Saccharomyces cerevisiae (Baker’s yeast)
  3. Chaetomium cellulolyticum

Question 5.
Why are plants obtained by protoplast fusion called somatic hybrids?
Answer:

  1. Isolated protoplast from two different varieties of plants each having a desirable character- can be fused to get hybrid protoplasts which can be further cultured to form a novel plant.
  2. Hybrid derives from fusion of vegetative (somatic) or body cells unlike that of fusion of sex cells is called somatic hybrid.

TS Inter 2nd Year Botany Study Material Chapter 13 Strategies for Enhancement in Food Production

Question 6.
What is protoplast fusion?
Answer:

  1. Nacked plant cells produced by digesting cell walls using cellulose and pectinose are called protoplasts.
  2. The fusion of isolated protoplast from two different varieties of plants is called protoplast fusion.

Question 7.
Why is it easier to culture meristems compared to permanent tissues’?
Answer:

  1. Meristems are undifferentiated, embryonal living plant cells which have the capacity of cell divisions and hence easy to culture.
  2. Permanent tissues consists of differentiated cells that have to undergo dedifferentiation to undergo cell division and hence difficult to culture.

Question 8.
Why are protein synthesized from Spirulina called single cell proteins?
Answer:

  1. Spirulina is a unicellular alga and is rich source of protein.
  2. Dried biomass of a single species of microbe used as a protein source in the diet is •known as Single Cell Protein.

Question 9.
A person who is allergic to pulses are advised to take a capsule of Spirulina dialy. Give reasons for the advice. [May 2014]
Answer:
Pulses contain proteins, Similarly Spirulina also contains proteins. So if a person is allergic to pulses he can take Spirulina for proteins.

Question 10.
Would it be wrong to refer to plants obtained through micro propagation as ‘Clones’? Explain.
Answer:

  1. No, since the formation of plants through micro propogation does not involve fusion of sex cells from two parents, they can be called as Clones.
  2. The plants produced by Micropropagation are genetically identical to the origin or source plant and hence they are called Somaclones.

Question 11.
How is somatic hybrid different from a hybrid?
Answer:

  1. Two different plants of desired characters are crossed to form a hybrid. It is a product of sexual reproduction.
  2. Isolated protoplasts from vegetative cells of two different plants, each having a desirable character – can be fused to get hybrid, protoplast, and is cultured to form somatic hybrid.

Question 12.
What is emasculation? Why and when is it done?
Answer:

  1. Removal of anthers from bisexual flowers of female parent, when the flowers are still in bud condition is called emasculation.
  2. It prevents self-pollination and ensures artificial cross pollination.

Question 13.
Discuss the two main limitations of plant hybridization programme.
Answer:

  1. It is not necessary that the hybrids do combine the desirable characters. Usually only one in a few hundred to a thousand crosses show the desirable combination.
  2. Selection of superior recombinants and subjecting them to self pollination to achieve homozygosity so that the characters will not segregate in the progeny.

TS Inter 2nd Year Botany Study Material Chapter 13 Strategies for Enhancement in Food Production

Question 14.
Give two important contributions of Dr. M.S. Swaminathan.
Answer:

  1. Swaminathan and his team developed short duration high-yielding varieties of Rice including scented Basmati.
  2. He introduced Mexican varieties of wheat in India.

Question 15.
Which two species of sugarcane were crossed for better yield?
Answer:

  1. Saccharum barberi of North India had poor sugar content and Saccharum officinarum of South India had higher sugar content were crossed to produce a new varety with desirable qualities.
  2. New variety has high yield, thick stems, high sugar and grow well in North India.

Short Answer Type Questions

Question 1.
What is meant by germplasm collection? What are its benefits?
Answer:
The entire collection of plants / seeds, having all the diverse alleles for all genes in a given crop is called germplasm collection.

  1. Cell and tissue cultures of many plant species can be preserved maintained in a viable state for several years and used when required.
  2. Plant materials from endangered species can be conserved using this method.
  3. It is an ideal method for long term conservation of cell cultures producing secondary metabolites such as antibiotics.
  4. Seeds which loose their viability or storage can be maintained for a long period of time.
  5. Disease free plant material can be frozen and propagated whenever required.
  6. Conservation of Somaclonal variations in cultures.
  7. Rare germplasms developed by using Somatic hybridisation other genetic manipulation techniques can be stored.
  8. Pollen conservation for enhancing longevity.
  9. Germplasm banks to facilitate the exchange of information of international level.

Question 2.
Name the improved characteristics of wheat that helped India to achieve green revolution.
Answer:

  1. Green revolution is the dramatic increase in food production due to plant breeding ā€ž techniques.
  2. During the period 1960 to 2000, wheat production increased from 11 million tonnes to 75 million tonnes this is due to development semi-dwarf variety of wheat.
  3. Semi-dwarf wheat was developed by Norman E.Borlaug at International Centre for Wheat and Maize improvement in Mexico.
  4. In 1963, several varieties such as Sonalika and Kalyan Sona which were high yielding and disease resistant, were introduced all over the wheat growing belt of India.

Question 3.
Suggest some of the features of plants that prevent insect and pest infestation.
Answer:

  1. Major cause for large scale destruction of crop plant and crop produce is insect and pest infestation.
  2. Insect resistance in host crop plants may be due to morphological, biochemical or physiological characteristics.
  3. Hairy leaves in several plants are associated with resistance to insect pests, e.g.: resistance to jassids in cotton and cereal leaf beetle in vyheat.
  4. In wheat, solid stems lead to non-preference by the stem sawfly.
  5. Smooth leaved and nectar-less cotton varieties do not attract bollworms.
  6. High aspartic acid, low nitrogen and sugar content in maize leads to resistance to maize stem borers.
CropVarietyInsect Pests
Brassica
(rapeseed, mustard)
Pusa GauravAphids
Flat beanPusa Sem 2,
Pusa Sem 3
Jassids, aphids and fruit borer.
Okra (Bhindi)
(Lady’s Finger)
Pusa SawaniShoot and Fruit borer
Pusa A-4

TS Inter 2nd Year Botany Study Material Chapter 13 Strategies for Enhancement in Food Production

Question 4.
The culture medium (nutrient medium) can be referred to as a ‘highly enriched laboratory soil’. Justify the statement.
Answer:
Culture medium must provide a carbon source such as sucrose and also in organic salts, vitamins, amino acids and growth regulators like auxins, cytokinins etc.

The culture medium is rich in nutrients.

Question 5.
Plants raised through tissue cultures are clones of the ‘parent’ plant.’ Discuss the utility of these plants.
Answer:

  1. Plants produced through tissue culture are genetically identical to the original or source plant and hence they are called somaclones.
  2. Many economically important plants like tomato, banana, apple, teak, eucalyptus, bamboo etc. have been produced on a commercial scale by the use of this method.
  3. Recovery of healthy plants from diseased plants can be done.
  4. One can remove the meristem and growin in vitro to obtain virus free plants.
  5. Scientists have succeeded in culturing meristems of banana, sugarcane, potato etc.

Question 6.
Discuss the importance of testing of new plant varieties in a geographically vast country like India.
Answer:

  1. The newly selected lines are evaluated for their yield and other agronomic traits of quality, disease resistance etc.
  2. This evaluation is done by growing these in research fields and recording their performance under ideal fertiliser application, irrigation and other crop management practices.
  3. The evaluation in research fields is followed by testing the materials in farmer’s fields, for at least three growing seasons at several locations in the country, representing all the agroclimatic zones where the crop is usually grown.
  4. The material is evaluated in comparison to the best available local crop cultivar-a check or reference cultivar.

Question 7.
Give few examples of biofortified crops. What benefits do they offer to the society?
Answer:
Biofortified crops are with higher levels of vitamins and minerals, or higher protein and healthier fats. It is the most practical means to improve public health of the society.

Examples of fortified crops :

  1. Atlas 66 used as a donor for developing wheat varieties with improved protein content.
  2. Maize hybrids have increased amount of aminoacid lysine and tryptophan.
  3. Iron fortified rice have increased iron content.
  4. India Agricultural Research Institute, New Delhi have released some fortified crop

varieties:
a) Carrot, spinach and pumpkin – Vitamin A
b) Bitter gourd, bathua, mustard, tomato – Vitamin C
c) Spinach and bathua – Iron and Calcium.
d) Broad bean, lablab, fresh bean and garden pea – Protein.

Question 8.
Mutations are beneficial for plant breeding. Taking an example, justify the statement.
Answer:

  1. Mutations is defined as sudden heritable change in the character of an organism, due to change in the sequence of bases of the gene.
  2. Few mutations may create numerous new varieties of economic value.
  3. Due to mutation breeding the farmers need not depend on nature for variation.
  4. It is possible to induce mutation artificially through the use of chemicals or radiations (like gamma radiations) and selecting and using the plants that have a desirable character as a source in breeding. This is called mutation breeding.
    Eg: In mung bean, resistance to yellow mosaic virus and powdery mildew were induced by mutations.

TS Inter 2nd Year Botany Study Material Chapter 13 Strategies for Enhancement in Food Production

Question 9.
Discuss briefly the technology that made us self-sufficient in food production.
Answer:

  • Technology called Tissue Culture made us self sufficient in food production.
  • By applying this technology, it is possible to produce a large number of plants in a very short time and limited space. Hence this technique is called micro propagation.
  • Plants thus produced are genetically identical to the original or source plant and hence they are called somaclones.
  • Many economically important plants like tomato, banana, apple, teak, eucalyptus, bamboo etc., have been produced on a commercial scale by the use of this method.
  • Plant breeding as a technology has helped increased yield to a large extent. The green revolution was dependent on plant breeding techniques for developing high yielding and disease resistant varieties like rice, maize.
  • Mutation breeding and rDNA technique also play important role in increasing food production.
  • By mutation breeding, disease resistant crops were developed which prevented from large destruction.

Long Answer Type Questions

Question 1.
You are a Botanist working in the area of plant breeding. Describe the various steps that you will undertake to release a new variety. [Mar. ’18; May ’17, ’14]
Answer:
The steps in breeding a new genetic variety of a crop are

  1. Collection of variability.
  2. Evaluation and Selection of parents.
  3. Cross hybridisation among selected parents.
  4. Selection and testing of superior recombinants.
  5. Testing, release and commercialization of new cultivars.

i) Collection of variability :

  1. Genetic variability is important for any breeding programme.
  2. Pre-existing genetic variability available in wild varieties, species and relatives of crop species is collected and preserved.
  3. Evaluation of their characteristics is a pre-requisite for the effective exploitation of natural genes available in the population.
  4. The entire collection of plants / seeds having all diverse alleles for all genes in a given crop is called germplasm collection.

ii) Evaluation and selection of parents :
a) It is carried out by evaluating germplasm to identify plants with desirable combination of characters.
b) The selected plant is multiplied and hybridized.
c) By self-pollination, purelines are created wherever desired.

iii) Cross hybridization among selected parents :

  1. Cross hybridization is carried out to combine desired genetic characters from two different plants (parents).
  2. Cross hybridization is a time consuming and tedious process as it involves collection of pollen grains from the desired plants and other pollination techniques to incorporate desired traits.
  3. It is also not certain the hybrids combine desired characters. The chances of desirable combination is usually only one in few hundred to a thousand crosses carried out.

iv) Selection and testing of superior combinants :

  1. This step consists of selection of plants among the progeny of the hybrids with desired combination of characters.
  2. It yields plants that are superior to both of the parents. This is known as hybrid vigour / heterosis.
  3. They are self pollinated for several generations till they reach a state of uniformity or homozygosity so that characters will not segregate in the progeny.

v. Testing, release and commercialization of new cultivars :

  1. Evaluation is done for newly selected lines for their yield and other agronomic traits of quality, disease resistance etc.
  2. Selected plants are grown in research fields and their performance is recorded under ideal fertilizer application irrigation and other crop management practices.
  3. Testing of hybrid line is done in farmer’s field after evaluation.
  4. After testing, the crop is grown at different locations in the country with different agroclimatic zones for at least three growing seasons.
  5. The tested material is evaluated in comparison to the best available local crop cultivar used as reference cultivar.
  6. Release of tested material is done in bulk after selection and certification.

Question 2.
Describe the tissue culture technique and what are the advantages of tissue culture over conventional method of plant breeding in crop improvement programmes? [Mar. 2020, 2019, 17, 14]
Answer:
The technique of growing, culturing and maintaining plant cells, tissues and organs in vitro is called tissue culture. Tissue culture is done by following methods :
1) Preparation of nutrient culture medium :
The nutrient medium must provide a carbon source such as sucrose and also inorganic salts, vitamins, amino acids and growth regulators like auxins, cytokinins etc.

2) Sterilization of the culture medium :

  1. The medium is rich in nutrients and therefore, attracts the growth of microorganisms. The medium should be sterilized.
  2. Sterilization is carried out in a steam sterilizer called autoclave.
  3. The culture medium is autoclaved for 15 min, at 121°C and 15 lbs pounds of pressure.

3) Preparation of explant:
Any part of the plant body which is used as inoculum is called explant.

4) Inoculation of explants :
The transfer of explants on to the sterilized nutrient culture medium is called inoculation and is carried out in an aseptic condition.

5) Incubation of growth :

  1. The cultures are incubated for 3 to 4 weeks during which period the cells of the explant absorb the nutrients, grow and undergo repeated divisions to produce undifferentiated mass of cells known as Callus.
  2. Sometimes sheets or roots may be produced directly. ,
  3. The explants or callus cultured on different combinations of auxins and cytokinins will produce shoots or roots and this process is called organogenesis.
  4. Alternately, embryo like structures develop from the callus and this phenomenon is known as somatic embryogenesis, the embryo-like structure which develop from the callus are called embryoids. Since these embryoids develop from somatic tissue they are also called Somatic embryos.

6) Acclimatization of plantlets and transfer to pots :
The plants generated through organogenesis (or) somatogenesis need to be acclimatized before they are transferred to pots.

Advantages of tissue culture :

  1. More number of plants can be produced in a short time.
  2. Disease free plants can be developed from diseased plants.
  3. Seedless plants can be multiplied.
  4. Female plants are selectively produced through tissue culture.
  5. Somatic hybrids can be raised by tissue culture, where sexual hybridization is not possible.

Flow chart showing Plant Tissue culture Technique
TS Inter 2nd Year Botany Study Material Chapter 13 Strategies for Enhancement in Food Production 1

Question 3.
Modern methods of breeding plants can alleviate the global food ‘shortage’. Comment on the statement and give suitable examples.
Answer:
The development of several high yielding varieties of wheat and rice in the mid 1960’s as a result of various plant breeding techniques led to dramatic increase in food production in our country. This phase is often referred as green revolution.

High yielding and disease resistant varieties were introduced in India e.g. Sonalika and Kalyan Sona.

  • Semi dwarf varities of rice e.g.: IR-8 Taichung Nalive -1 were introduced in 1966.
  • Better yielding semi-dwarf varieties i.e., Jaya and Ratna were developed in India.

Successful developed high yield varieties of maizy jowar and bajra were obtained by hybrid breeding.

Plant breeding for disease resistance had enhance food production breeding is carried out by convention breeding techniques or by mutation breeding, e.g. In mung bean, resistance to yellow mosaic virus and powdery mildew were induced by mutations.

Plant breeding for developing resistance to insect pests :
Major cause for large scale destruction of crop plant and crop produce is insect and pest infestation. Insect resistance in lost crop plants may be due to morphological, biochemical or physiological characteristics.

Examples:

  1. Wheat – Hairy leaves – resistance to cereal leaf beetle
  2. Maize – High aspartic acid and low nitrogen and sugar contents – resistance to stem borer
  3. Wheat – Solid stem – resistance to sawfly
  4. Cotton – Smooth leaves and nectar-less condition – resistance to bollworm
  5. Cotton – Hairy leaves – resistance to. sawfly

Plant breeding for improved food quality :
Breeding crops with higher levels of vitamins and minerals or higher protein and healthier fats is called Biofortification. It is the practical means to improve public health.

Examples:

  1. Lysine and tryptophan rich maize.
  2. High protein rich wheat.
  3. Iron fortified rice.
  4. Vitamin enriched bitter gourd, tomato, mustard, bathua.
  5. Iron and Calcium enriched spinach and bathua.
  6. Vitamin A rich carrots, spinach and pumpkin.

Single Cell Protein :
Microbes are grown on an industrial scale and used as nutrient rich food. E.g.: Spirulina.

Tissue Culture:
Technique of regeneration of whole plant from any part of the plant by growing it on suitable culture medium under aseptic conditions in vitro.

Advantages:

  1. 1) A number of plants can be grown in a short period of time, e.g.: Tomato, banana, apple, teak, eucalyptus etc.
  2. Healthy disease free plant can be grown by meristem culture, e.g.: Banana, sugarcane, potato etc.
  3. Somatic hybrid can be raised by tissue culture where sexual hybridisation is not possible.
    e.g.: Pomato

TS Inter 2nd Year Botany Study Material Chapter 13 Strategies for Enhancement in Food Production

Question 4.
Discuss how the property of plant cell totipotency has been utilized for plant propagation and improvement.
Answer:
Totipotency of a cell can be defined as the capacity of a cell to generate into a whole plant.
Requirements:
i) Explant :
It is any part of a plant taken out for growing a new planfin special nutrient medium under sterile / aseptic conditions.

ii) Nutrient medium :
It must have a carbon source such as sugar, inorganic salts, vitamins, amino acids, growth regulators like auxins, cytokinins etc.

iii) Suitable conditions of light and temperature. This is a tissue culture method by which a number of genetically similar plants called somadones are grown.

Utilization for plant propagation and improvement:

  1. By utilizing this property of totipotency thousands of plants can be grown in a short period. Hence this technique is called micropropagation.
  2. Plants are genetically identical, so certain desirable characters can be continued through generations.
  3. Many economically important plants like tomato, banana, apple, teak, eucalyptus, bamboo etc. have been produced on a commercial scale by the use of this method.
  4. Meristem Culture : This method is useful in recovery of healthy plant from diseased plants. Although plant is infected with a virus, meristems are free of virus. One can remove the meristem and grow it in vitro to obtain virus free plants.
  5. Scientists have succeeded in culturing meristems of banana, sugarcane, potato etc.
  6. Plants are genetically identical, so certain desirable characters can be continued through generations.
  7. Hybrids can be produced by hybridisation.
  8. Somatic hybridization offer vast potential for manipulation of plants in vitro to produce new varieties, e.g.: Pomato

Question 5.
What are the three options to increase food production? Discuss each giving the salient features, merits and demerits.
Answer:
Mutation breeding, tissue culture and r DNA technique, are going to play a pivotal role in enhancing food production.

Salient features of mutations :

  1. Mutation is a phenomenon which results in alteration of genes (= DNA sequence).
  2. It results in changes in the genotype and the phenotype of an organism.
  3. In addition to recombination, mutation is another phenomenon that leads to variation in DNA.
  4. The process of breeding by artificially inducing mutations using chemicals or radiations.
  5. Breeding for disease resistance is carried out by mutation breeding.

Merits:

  1. Mutation generates a large amount of variability in a population.
  2. Plant breeder can select the desirable types.
  3. Improved varieties of crop plants with desirable characters can be obtained after careful selection & hybridization.

Demerits:
1) It results in changes in the genetic makeup which could be lethal and results in the death of an individual.

Tissue culture:

  1. Tissue culture is a technique of regeneration of a whole plant from any part of a plant by growing it on culture medium under aseptic conditions.
  2. The capacity of a cell explant to grow into whole plant is called totipotency.
  3. Explant is the part of plant taken for tissue culture.
  4. The method of growing or producing thousands of plants through tissue culture is called micropropagation.
  5. The plants produced from tissue culture are genetically identical to the original plant from which they are grown, so they are called somaclones.

Merits:

  1. More number of plants can be produced in a short time.
  2. Disease free plants can be developed from diseased plant.
  3. Seedless plants can be multiplied.

Demerits:

  1. No new combinations of traits.
  2. All the plants that are produced have the same genetic material. So they are equally vulnerable to environmental factors, infections and pests.

r DNA technology:

  1. Genetic engineering is a laboratory technique of gene manipulation which brings about novel combination of genes.
  2. Recombinant DNA technology enables us to isolate a gene of interest in an organism which can be inserted into a vector and make it express its native characteristics.

Merits:

  1. r DNA technologies will play a key role in preventing genetic diseases.
  2. It produces targeted medicines (like insulin for diabetic patients).
  3. It will also impart agriculture to resists diseases.

Demerits:

  1. Genetically modified plants spreading beyond control and driving out local species.
  2. Expensive lab facilities.
  3. Maintaining sterile environment.

Intext Question Answers

Question 1.
Describe in brief various steps involved in plant breeding.
Answer:
Plant breeding is the process in which two genetically dissimilar varieties are purposely crossed to produce a new hybrid variety. As a result, characteristics from both parents can be obtained in the hybrid plant variety. Thus it involves the production of a new variety with the desired characteristics such as resistance to diseases, climatic adaptability and better productivity. The various steps involved in plant breeding are as follows.

a) Collection of genetic variability :
Genetic variability from various wild relatives of the cultivated species are collected to maintain the genetic diversity of a species. The entire collection of the diverse alleles of a gene in a crop is called the germplasm collection.

b) Evaluation of germplasm and selection of parents :
The germplasm collected is then evaluated for the desirable genes. The selected plants with the desired genes are then used as parents in plant breeding parents in plant breeding experiments and are multiplied by the process of hybridization.

c) Cross-hybridization between selected parents :
The next step in plant breeding is to combine the desirable characters present in two different parents to produce hybrids. It is a tedious job as one has to ensure that the pollengrains collected from the male parent reach the stigma of the female parent.

d) Selection of superior hybrids :
The progenies of the hybrids having the desired characteristics are selected through scientific evaluation. The selected progenies are then self-pollinated for several generations to ensure homozygosity.

e) Testing, release and commercialization of new cultivers :
The selected progenies are evaluated for characters such as yield resistance to disease performance etc., by growing them in research fields for at least three growing seasons in different parts of the country. After thorough testing and evaluation, the selected varieties are given to the farmers for growing in fields for a large scale production.

TS Inter 2nd Year Botany Study Material Chapter 13 Strategies for Enhancement in Food Production

Question 2.
What is meant by biofortification?
Answer:
Biofortification is a process of breeding crops with higher levels of vitamins, minerals, proteins and fat content. This method is employed to improve public health. Breeding of crops with improved nutritional quality is undertaken to improve the content of proteins, oil, vitamins, minerals and micro nutrients in crops. It is also undertaken to upgrade the quality of oil and proteins. An example of this is a wheat variety known as Atlas 66, which has high protein content in comparison to the existing wheat, in addition, there are several other improved varieties of crop plants such as rice, carrots, spinach etc. Which have more nutritious value and more nutrients than the existing varieties.

Question 3.
Which part of the plant is best suited for making virus-free plants and why?
Answer:
Apical and axillary meristems of plants is used for making virus-free plants in a diseased plant. Only this region is not infected by the virus as compared to the rest of the plant region. Hence the scientists remove axillary and apical meristems of the diseased plant and grow it in vitro to obtain a disease-free and healthy plant. Virus-free plants of banana, sugarcane and potato have been obtained using this method of scientists.

Question 4.
What is the major advantage of producing plants by micropropagation?
Answer:
Micropropagation is a method of producing new plants in a short duration using plant tissue culture. Some major advantages of micropropagation are as follows.
a) Micropropagation helps in the propagation of a large number of plants in a short span of time.
b) The plants produced are identical to the mother plant.
c) It leads to the production of healthier plantlets which exhibit better disease resisting powers.

Question 5.
Find out what are the various components of the medium used for propagation of an explant in vitro?
Answer:
The major components of medium used for propagation of explants in vitro are carbon sources such as sucrose, inorganic salts, vitamins, amino acids, water, agar-agar and certain growth hormones such as auxins and gibberellins.

Question 6.
Name any five hybrid varieties of crop plants which have been developed in India.
Answer:
The five hybrid varieties of crop plants which have been developed in India are

Crop plantHybrid variety
WheatSonalika and Kalyan Sona
RiceJaya and Ratna
CauliflowerPusa Shubra and Pusa snowball K-1
CowpeaPusa komal
MustardPusa swarnim (Karan rai)

TS Inter 2nd Year Botany Study Material Chapter 13 Strategies for Enhancement in Food Production

Question 7.
The term ‘desirable trait’ can mean different things for different plants. Justify the statement with suitable examples.
Answer:
In case of rice, high yield and resistant to unfavourable conditions (like strom etc) is necessary. Hence the desirable trait is rice is high yield and resistant to unfavourable conditions. So semi-dwarf varieties are developed. In sugarcane desirable qualities are high yield, thick stem & high sugar. In wheat which are attached by rust the desirable trait in disease resistance. Similarly in case of lady finger plant insect resistance is a desirable character. This desirable traits are different for different plants.

Question 8.
Is there any relationship between dedifferentiation and higher degree of success achieved in plant tissue culture experiments?
Answer:
No, dedifferentiation occurs when a cell line is transformed, that means it becomes cancerous.

Question 9.
“Give me a living cell of any plant and I will give you a thousand plants of the same type”. Is this only a slogan or is it scientifically possible? Write your comments and justify them.
Answer:
It is not a slogan. It is possible scientifically by tissue culture techniques. The capacity to generate a whole plant from any cell is called totipotency. Large number of plants can be produced in a very short time and in limited space. Hence the technique is called Micro-propagation.

TS Inter 2nd Year Botany Study Material Chapter 13 Strategies for Enhancement in Food Production

Question 10.
What are the physical barriers of a cell in the protoplast fusion experiment? How are the barriers overcome?
Answer:
The cell wall acts as a physical barrier of a cell in the protoplast fusion experiment. The barriers can be overcome by using hydrolyzing enzymes like cellulase and pectinase.

TS Inter 2nd Year Botany Study Material Chapter 12 Biotechnology and its Applications

Telangana TSBIEĀ TS Inter 2nd Year Botany Study Material 12th Lesson Biotechnology and its Applications Textbook Questions and Answers.

TS Inter 2nd Year Botany Study Material 12th Lesson Biotechnology and its Applications

Very Short Answer Type Questions

Question 1.
Expand GMO. How is it different from a hybrid?
Answer:

  1. GMO means Genetically Modified Organisms.
  2. Hybrids are new crop varieties produced by crossing two genetically different parents whereas GMO are plants, bacteria, fungi or animals whose genes have been altered by manipulation.

Question 2.
Give different types of cry genes and pests which are controlled by the proteins encoded by these genes.
Answer:

  1. Genes Cry I Ac and Cry II Ab control the cotton bollworms.
  2. Genes Cry I Ab controls corn borer.

Question 3.
Can a disease be detected before its symptoms appear? Explain the principle involved. [Mar. 2019, 2017]
Answer:

  1. Yes, very low concentration of Bacteria or virus can be detected by amplification of their nucleic acids through PCR.
  2. ELISA is used to detect infection by a pathogen based on the principle of antigen-antibody interaction.

Question 4.
Many toxic proteins are produced in their inactive form by micro-organisms. Explain how the mechanism is useful for the organism producing the toxin.
Answer:

  1. The Bt toxin proteins exist as inactive protoxins but once an insect ingests the inactive toxin, it is converted into an active form of toxin due to the alkaline pH of the gut which solubilises the crystals.
  2. The activated toxin binds to the surface of midgut epithelial cells and creates pores that cause swelling and lysis and eventually cause the death of the insect.

Question 5.
Why has the Indian parliament cleared the second amendment of the country’s patents bill?
Answer:

  1. Amendment of the Indians patents bill by the Indian parliament, prevents unauthorized exploitation of their bioresources and traditional knowledge.
  2. It also considers patent terms, emergency. Provisions and research and development initiatives.

TS Inter 2nd Year Botany Study Material Chapter 12 Biotechnology and its Applications

Question 6.
Give any two reasons why the patent on Basmati should not have gone to an American company. [May 2014]
Answer:

  1. Basmatic rice is distinct for its Unique aroma and flavour and 27 documented varieties of Basmati are grown in India.
  2. There is reference to Basmati in ancient texts, forklore and poetry, as it has been grown in India for centuries. The new variety of Basmati produced by American company had actually been derived from Indian farmers variety.

Question 7.
PCR is a useful tool for early diagnosis of an infectious disease. Elaborate.
Answer:

  1. The very low concentration of a bacteria or virus can be detected by amplification of their nucleic acid through PCR.
  2. PCR is now used to detect HIV in suspected AIDS patient. It is used to detect mutations in genes, in suspected cancer patients too. It is a powerful technique to identify many genetic disorders.

Question 8.
What is GEAC and what are its objectives? [Mar. ’18, ’14; May ’17]
Answer:

  1. GEAC – Genetic Engineering Approval Committee, established by Govt, of India.
  2. It make decisions regarding the validity of GM research and the safety of introducing GM organisms for public services.

Question 9.
Name the nematode that infects the roots of tobacco plants. Name the strategy adopted to prevent this infestation.
Answer:

  1. A nematode, Meloidegyne incognitia infects the roots of tobacco plants and causes a great reduction in yield.
  2. This infestation can be prevented based on the process of RNA interference (RNAi).

Question 10.
For which variety of Indian rice, has a patent been filed by a USA company.
Answer:

  1. Basmati variety of rice with unique aroma and flavour.
  2. Indian Basmati was crossed with semi dwarf varieties and claimed as an invention (a novelty) by an American company for patent in 1997.

TS Inter 2nd Year Botany Study Material Chapter 12 Biotechnology and its Applications

Question 11.
Give one example for each of transgenic plants which are suitable for food processing and those with improved nutritional quality. [Mar. 2020]
Answer:

  1. Transgenic tomato ‘Flavr Savr’ is bruise resistant, i.e., suitable for storage and transport due to delayed ripening and offers longer shelf life.
  2. Transgenic golden rice obtained from “Taipei” is rich in vitamin A and prevents blindness.

Short Answer Type Questions

Question 1.
List out the beneficial aspects of transgenic plants. [March 2019, Mar. ’18; May ’17, ’14]
Answer:
Beneficial aspects of transgenic plants are
I. Transgenic crop plants having resistance to pathogens and pests :

  1. Transgenic papaya is resistant to papaya ring spot virus.
  2. Bt. cotton is resistant to insects.
  3. Transgenic tomato plants are resistant to the bacterial pathogen pseudomonas.
  4. Transgenic potato plants are resistant to the fungus phytophthora.

II. Transgenic plants suitable for food processing technology :
Transgenic tomato ‘Flavr Savr’ is bruise resistant i.e., suitable for storage and transport due to delayed ripening and offers longer shelf life.

III. Transgenic plants with improved nutritional value :
Transgenic golden rice obtained from ‘Taipei’ is rich in vitamin A and prevents blindness.

IV. Transgenic plants useful for hybrid seed production :
Male sterile plants of Brassica napus are produced. This will eliminate the problem of manual emasculation and reduce the cost of hybrid seed production.

V. Transgenic plants tolerant to abiotic stresses caused by chemicals, cold, drought, salt, heat etc.

  1. Basmati variety of rice was made resistant against biotic and abiotic stresses.
  2. Round up ready soyabean is herbicide tolerant.

Question 2.
What are some bio-safety issues concerned with genetically modified crops? [March 2017, 2014]
Answer:
Biosafety issues concerned with genetically modified crop are :

  1. There is fear of transferring allergins or toxins to humans and animals as side effects.
  2. There is a rick of changing the fundamental nature of vegetables.
  3. They may pose a harmful effect on biodiversity and have an adverse impact on environment.
  4. There is a risk of gene pollution due to transfer of the new genes into related wild species through natural out-crossing. This may result in the development of super weeds which may be fast growing than the crops and may be resistant to weedicides.
  5. They may bring about changes in natural evolutionary pattern.

Question 3.
Give a brief account of A) Bt. cotton [Mar. 2020]
B) Pest resistant plants
Answer:
A) Bt Cotton :
Bt cotton is created by using some strains of a bacterium, Bacillus thuringiensis (Bt is short form).

  1. This bacterium produces protein that kill certain insects such as lepidopterans (tobacco, bud worm, army worm), coleopterans (beetles) and dipterans (flies, mosquitoes).
  2. B.thuringiensis forms protein crystals during a particular phase of growth. These crystals contain a toxic insecticidal protein.
  3. Bt toxin protein exists as inactive protoxins but once an insect ingests the inactive toxin, it is converted into an active form of toxin due to alkaline pH of the gut which solubilises the crystals. .
  4. The activated toxin binds to the surface of midgut epithelial cells and create pores that cause cell swelling and lysis leading to death of an insect.
  5. Specific Bt toxin genes were isolated from Bacillus thuringiensis and incorporated into several crop plants.
  6. Most Bt toxins are insect group specific. Hence, the toxin is coded by a gene named ‘cry’. For example, the proteins encoded by the genes Cry I Ac and Cry II Ab control the cotton bollworms and Cry I Ab controls corn borer.

B) Pest resistant plants are developed by using biotechnology processes :

  1. A nematode Meloidegyne incognitia infects the roots of tobacco plants which reduces the production of tabaco.
  2. RNA interference (RNA i) process is used to check by silencing of a specific mRNA due to a complementary RNA molecule. It occurs in all eukaryotic organisms as a method of cellular defense.
  3. RNA binds and prevents translation of the mRNA (silencing).
  4. Agrobacterium vectors are used to introduce – specific genes into the host plant. It produces both sense and anti – sense RNA in the host cells.
  5. These two RNAs are complementary to each other and formed a double stranded RNA (ds RNA) that initiate RNAi and hence silenced the specific mRNA of the nematode.
  6. The parasite cannot survive in transgenic host, so prevents the plants from pest. The transgenic plant, thus gets itself protected from the parasite.

TS Inter 2nd Year Botany Study Material Chapter 12 Biotechnology and its Applications

Question 4.
Write notes on green revolution and gene revolution.
Answer:
Green revolution :
i) Around 1960s, several countries including India experienced substantial and dramatic increase in agricultural production which was termed as green revolution by William Gaud.
Norman Borlaug is regarded as “Father of Green Revolution”.

ii) Green revolution increased food production by the following ways.

  1. Use of improved crop varieties
  2. Use of agro-chemicals (fertilizers and pesticides)
  3. Use of better management practices
  4. By land reforms

Gene Revolution :
With the advent of biotechnology, especially the genetic engineering, has increased the food production and decreased the use of chemical fertilizers and pesticides which lead to other type of revolution called Gene revolution.

Gene revolution provided new plants that would to lead to a more environmentally sound agricutural production.
GR plants are useful in many ways. Their

  1. production of high yeilding and disease resistant varieties.
  2. made crops more tolerant to abiotic stresses (cold, drought; salt, heat).
  3. reduced reliance on chemical pesticides (Pest-resistant crops) eg : Bt Cotton.
  4. helped to reduce past harvest losses.
  5. increased efficiency of mineral usage by plants. This prevents early exhaustion of fertility of soil.
  6. enhanced nutritional value of food. Eg : Vitamin A enriched rice.

Long Answer Type Questions

Question 1.
Give an account of bio-technological applications in agriculture and other fields.
Answer:
Bio-technology application in agriculture : Involves following three options

  1. Agro-chemical based agriculture
  2. Organic agriculture
  3. Genetically engineered crop based agriculture.

Genetically modified organisms (GMO) are plants, animals, bacteria and fungi whose genes have been altered by manipulation.

Genetic modification in organisms lead to following results :

  1. Crops become more tolerant to abiotic stresses, such as cold, drought, salt, heat, etc.
  2. Dependence on chemical pesticides reduced i.e., pest resistant crop.
  3. Post harvest losses reduced.
  4. Efficiency of mineral usage increased in plants (preventing loss of soil fertility).
  5. Nutritional value of food enhanced eg: Vitamin A enriched rice.
  6. Tailor-made plants are created to supply alternative resources to industries, in the form of starches, fuels and pharmaceuticals.

Some of the application of biotechnology in agriculture are the production of pest resistant plants, eg : Bt Cotton, Bt Corn, etc.

Bt. Cotton :
It is created by using some strains of a bacterium, Bacillus thuringiensis (Bt is short form).

  1. This bacterium produces protein that kill certain insects such as lepidopterans (tobacco budworm, armyworm), coleopterans (beetles) and dipterans (flies, mosquitoes).
  2. Bt toxin proteins exists as inactive protoxins but once insect ingest the inactive toxin it becomes active and leads to death of an insect.
  3. Most Bt toxins are insect group specific, hence the toxin is coded by a gene named cry. For example, the proteins encoded by the genes Cry II Ac and Cry I Ab control the cotton bollworms and Cry I Ab controls corn borer.

Pest resistant Plants are developed by using biotechnology processes.

  1. A nematode Meloidegyne incognitia infects the roots of tobacco plants which reduces the production of tobacco.
  2. Agro bacterium vectors are used to introduce nematode-specific genes into the host plant. It produces both sense and anti – sense RNA in the host cells.
  3. These two RNA are complementary to each other and forms a double stranded RNA (ds RNA) that initiate RNAi and hence silenced the specific mRNA of the nematode.
  4. The parasite cannot survive in transgenic host, so prevents the plants from pest. The transgenic plant thus gets itself protected from the parasite.

Biotechnology and Environment:
Bio remediation :
In the process of using microbes and plants to break down or recycle environmental pollutants.

Utilization of sewage and agrowastes to produce biogas and vermicompost.

Biotechnological application in medicine :
Have made immense impact in the area of health care by enabling the mass production of safe and more effective therapeutic drugs.

Vitamins (A, B12 etc.) and antibiotics (pencillin) are produced at low cost using microorganisms.

Genetically engineered insulin leads to sufficient availability of insulin for the management of adult onset diabetes.

Gene therapy is a collection of methods that allows correction of gene defects diagnosed in a child or embryo. Genes are inserted into a person’s cells or tissue to treat a disease. Molecular diagnosis helps to solve the problem of early diagnosis and treatment of diseases.

i) Using conventional methods of diagnosis (serum and urine analysis) early detection of diseases is not possible.
ii) To overcome this problem, some molecular diagnosis techniques provide early detection of diseases. These are
a) Recombinant DNA technology
b) Polymerase Chain Reaction
c) Enzyme Linked Immuno – Sorbent Assay (ELISA)

Intext Question Answers

Question 1.
Crystals of Bt toxin produced by some bacteria do not kill the liacteria themselves because –
a) bacteria are resistant to the toxin
b) toxin is immature;
c) toxin is inactive;
d) bacteria encloses toxin in a special sac.
Answer:
Toxin is inactive.

In bacteria the toxin is present in an inactive form, called pro toxin, which gets converted into active form when it enters the body of an insect.

TS Inter 2nd Year Botany Study Material Chapter 12 Biotechnology and its Applications

Question 2.
What are transgenic bacteria? Illustrate using any one example.
Answer:
Transgenic bacteria contain foreign gene that is intentionally introduced into its genome. They are manipulated to express the desirable gene for the production of various commercially important products. An example of transgenic bacteria is E.Coli. In the plasmid of E.coli, the two DNA sequences corresponding to A and B chain of human insulin are inserted, so as to produce the respective human insulin chains. Hence after the insertion of insulin gene into the bacterium, it becomes transgenic and starts producing chains of human insulin. Later on these chains are extracted from E.coli and combined to form human insulin.

Question 3.
Compare and contrast the advantages and disadvantages of production of genetically modified crops.
Answer:
The production of genetically modified (GM) or transgenic plants have many advantages.

  1. Most of the GM crops have been developed for pest resistance, which increases the crop productivity and therefore reduces the reliance on chemical pesticides.
  2. Many varieties of GM food crops have been developed, which have enhanced nutritional quality.
    For example : Golden rice is a transgenic variety of rice which is rich in vitamin A.
  3. These plants prevent the loss of fertility of soil by increasing the efficiency of mineral usage.
  4. They are highly tolerant to unfavourable abiotic conditions.
  5. The use of GM crops decreases the post harvesting loss of crops. However there are certain controversies regarding the use of genetically modified crops around the world. The use of these crops can affect the native biodiversity in an area. For example : The use of Bt toxin to decrease the amount of pesticide is posing a threat for beneficial insect pollinators such as honey bee. If the gene expressed for Bt toxin gets expressed in the pollen, then the honey bee might be affected. As a result, the process of pollination by honey bees would be affected. Also genetically modified crops are affecting human health. They supply allergens and certain antibiotic resistance markers in the body. Also they can cause genetic pollution in the wild relatives of the crop plants. Hence it is affecting our natural environment.

Question 4.
What are Cry proteins? Name an organism that produces it. How has man exploited this protein to his benefit?
Answer:
Cry proteins are encoded by cry genes. These proteins are toxins which are produced by Bacillus thuringiensis bacteria. This bacterium contains these proteins in their inactive form. When the inactive toxin protein is ingested by the insect it gets activated by the alkaline pH of the gut. This results in the lysis of epithelial cell and eventually the death of the insect. Therefore man has exploited this protein to develop certain transgenic crops with insect resistance such as Bt Cotton, Bt Corn, etc.

Question 5.
List the advantages of recombinant insulin.
Answer:

  1. Its molecular structure is absolutely identical to that of the natural molecule.
  2. It helps to have continuous supply of insulin and stabilization of its market price etc.

TS Inter 2nd Year Botany Study Material Chapter 12 Biotechnology and its Applications

Question 6.
What is meant by the term bio-pesticide? Name and explain the mode of action of a popular bio-pesticide.
Answer:
Bio pesticides are the plants which are having resistance to insects.
Example: Bt cotton.

  1. Bt cotton is created by using some strains of a bacterium, Bacillus thuringiensis (Bt is short form).
  2. Bt toxin protein exist as inactive protoxins, but once an insect ingets the inactive toxin, it is converted into an active form of toxin due to the alkaline pH of the gut which solubilise the crystals.
  3. The activated toxin binds to the surface of midgut epithelial cells and creates pores that cause cell swelling and lysis leading to death of an insect.

TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology: Principles and Processes

Telangana TSBIEĀ TS Inter 2nd Year Botany Study Material 11th Lesson Biotechnology: Principles and Processes Textbook Questions and Answers.

TS Inter 2nd Year Botany Study Material 11th Lesson Biotechnology: Principles and Processes

Very Short Answer Type Questions

Question 1.
Define biotechnology.
Answer:

  1. The European Federation of Biotechnology (EFB) defines Biotechnology as the intergration of natural science and organisms, cells, parts thereof, and molecular analogues for products and services.
  2. Biotechnology is the science of utilising the properties and uses of microorganisms or to exploit cells and the cell constituents at industrial level for generating useful products essential to life and human welfare.

Question 2.
What are molecular scissors? Where are they obtained from?
Answer:

  1. Molecular scissors are the restrition endonucleases that recognize and cut specific nucleotide sequences of DNA.
  2. They are usually obtained from Bacteria. For the first time, Herbert Boyer (1969) isolated two restriction enzymes from E.coli.

Question 3.
Name any two artificially restructured plasmids. [May 2014]
Answer:

  1. pBR 322 (named after Boliver and Rodriguez)
  2. pUC 19,101 (named after University of California)

Question 4.
What is EcoRI? How does it function?
Answer:

  1. EcoRI is a restriction enzyme obtained from a bacterium, Escherichia coli.
  2. This enzyme specifically recognises GAA sites on the DNA and cuts it between G and A.

Question 5.
What are cloning vectors? Give an example.
Answer:

  1. The DNA used for transforming and multiplying the foreign DNA sequences in a suitable host is called cloning vector.
  2. Plasmids, Bacteriophages, Cosmids, and artificial chromosomes are commonly used cloning vectors.

TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology: Principles and Processes

Question 6.
What is recombinant DNA?
Answer:

  1. The hybrid (chimeric)DNA formed by the intergration of a gene of interest within a suitable vector.
  2. Both source DNA and vector DNA are cut with same restriction enzyme and are joined with DNA ligase to make rDNA.

Question 7.
What is palindromic sequence?
Answer:

  1. Palindrome sequence: A sequence of base pairs that reads same on the two strands when orientation of reading is kept the same.
  2. Eg : 5′ – GAATTC – 3′
    3′ – CTTAAG – 5′

Question 8.
What is the full form of PCR? How is it useful in biotechnology? [March 2018]
Answer:

  1. PCR stands for Polymerase Chain Reaction. In this process, multiple copies of a gene are synthesized using a computerized machine called Thermocycler.
  2. Multiple copies (1 billion) of the gene of interest are synthesized in vitro using two sets of primers and a DNA polymerase (Taq polymerase).

Question 9.
What is downstream processing? [March 2019, May ’17, Mar. ’14]
Answer:

  1. Downstream processing : Separation and purification of a product that carried out after completion of the biosynthetic stage and before it is ready for marketing as a finished product.
  2. This includes formulation with preservatives, clinical trials (for drugs) and quality control testing etc.

Question 10.
How does one visualize DNA on an agar gel? [March 2020]
Answer:

  1. The separated DNA fragments can be visualised only after staining the DNA with a compound known as ethidium bromide followed by exposure to UV radiation.
  2. Bands of DNA in an ethidium bromide stained gel appear in bright in orange colour under UV light, in an instrument called transilluminator.

TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology: Principles and Processes

Question 11.
How can you differentiate between exonucleases and endonucleases?
Answer:
1. Exonucleases :
Nucleases that cut DNA and remove nucleotides from the ends.

2. Endonucleases :
Nucleases that cut specific positions within the DNA.

Short Answer Type Questions

Question 1.
Write short notes on restriction enzymes.
Answer:
Restriction enzymes or molecular scissors belong to a class of enzymes called nucleases. It always cut DNA molecules at a particular point by recognizing a specific sequence of six base pairs known as recognition sequence.
They are of two types.

  1. Exonucleases, which remove nucleotides from the ends of DNA.
  2. Endonucleases, which cut the DNA at specific portions anywhere within its length.

Each restriction endonuclease recognizes a specific palindromic nucleotide sequence in the DNA Palindrome is a group of letters that forms the same words when read both forward and backward, eg: MALAYALAM. It is a sequence in DNA of base pairs that reads same on the two strands. When orientation of reading is kept same.

For example, the following sequence reads the same on the two strands in 5′ → 3′ direction as well as 3′ → 5′ direction
5′ – GAATTC – 3′
3′ – CTTAAG – 5′

The restriction enzymes are named as follows.

  • The first letter of the name comes from the genus and the next two letters from the name of the species of the prokaryotic cell from which it is isolated.
  • The next letter comes from the strain of the prokaryote.
  • The Roman numbers following these four letters indicate the order in which the enzymes were isolated from that strain of the bacterium.
    eg : EcoRI from Escherichia coli RY13.
    Hind 11 from Haemophilus influenza.
    Bam H1 from Bacillus amyloliquefaciens.

Question 2.
Give an account of amplification of gene of interest using PCR.
Answer:
PCR stands for Polymerase Chain Reaction.

In this reaction, multiple copies of the gene (or DNA) of interest are synthesised in vitro using two sets of primers and the enzyme DNA polymerase. The enzyme extends the primers, using the nucleotides provided in the reaction and the genomic DNA as template.

If the replication of DNA is repeated many times, the segment of DNA can be amplified to approximately billion times i.e., 1 billion copies are made. Such repeated amplification is achieved by the use of a thermostable DNA polymerase such as Taq polymerase (isolated from a bacterium Thermus aquaticus) which remain active even during the high temperature induced denaturation of double stranded DNA. The amplified fragment, if desired, can now be used to ligate with a vector for further cloning.
TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology Principles and Processes 1

Question 3.
What is a bio-reactor? Describe briefly the stirring type of bio-reactor.
Answer:
Bioreactors are large volume (100 – 1000L) vessels in which raw materials are biologically converted into specific products, individual enzymes etc. using microbial plant, animal or human ceils.

  1. It provides all the optimal conditions for achieving the desired product by providing optimal growth conditions like temperature, pH, substrate, salt, vitamins and oxygen.
  2. The most commonly used bioreactors are of stirring type as shown in figure.
  3. The stirred-tank reactor is usually cylindrical or with a curved base to facilitate the mixing of the reactor contents.
  4. The stirrer facilitates even mixing and oxygen availability throughout the bioreactor.
  5. The components of a bioreactor are
    a) An agitator system
    b) An oxygen delivery system
    c) A foam control system
    d) A temperature control system
    e) pH control system
    f) Sampling ports to withdraw cultures periodically

TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology Principles and Processes 2
(a) Simple stirred – tank bioreactor;
(b) Sparged stirred-tank bioreactor through which sterile air bubbles are sparged

Question 4.
What are the different methods of insertion of recombinant DNA into the host cell?
Answer:
Methods of insertion of rDNA into the host cell:

  • The rDNA can be forced into the competent cells by incubating the cells with recombinant DNA on ice followed by placing them at 42°C and then putting them back on ice.
  • Microinjection is a method in which the recombinant DNA is directly injected into the nucleus of the animal cell with the help of microneedles or micropipettes.
  • Gene gun or biolistics is a method suitable for plant cells, where cells are bombarded with high velocity microparticles of gold or tungsten coated with DNA.
  • Disarmed pathogens are used as vectors, when they are allowed to infect the cell, they transfer the recombinant DNA into the host.

Long Answer Type Questions

Question 1.
Explain briefly the various processes of recombinant DNA technology. [Mar. 18 17, 14; May 14]
Answer:
Recombinant DNA technology involves several steps in specific sequence such as
a) Isolation of DNA
b) Fragmentation of DNA by restriction endonucleases
c) Isolation of a desired DNA fragment
d) Ligation of the DNA fragment into a vector
e) Transferring the recombinant DNA into the host
f) Culturing the host cells in a medium at large scale
g) Extraction of the desired product.

a) Isolation of DNA :

  1. DNA is enclosed within the membranes. To release DNA along with other macromolecules such as RNA, proteins, polysaccharides and lipids, bacterial cells / – plants or animal tissue are treated with enzymes such as lysozyme (bacteria) cellulose (plant cells), chitinase (fungus) to digest cell wall.
  2. RNA can be removed by treatment with ribonuclease.
  3. Proteins can be removed by treatment with protease.
  4. Other molecules can be removed by appropriate treatments and purified DNA ultimately precipitates out after the addition of chilled ethanol.

b) Fragmentation of DNA by restriction endonucleases :
Cutting of DNA at specific locations can be done by using restriction enzymes. The purified DNA is incubated with the specific restriction-enzymes at conditions optimum for the enzyme to act.

c) Isolation of a desired DNA fragment :
Is carried out using agarose gel electrophoresis the DNA is negatively charged, it moves towards the positive electrode or anode and in the process, DNA separates out. The desired DNA fragment is eluted out. Amplification of the gene of interest: Using Polymerase Chain Reaction (PCR) is a reaction in which amplification of specific DNA sequences is carried out in vitro.

i) PCR technique requires :

  1. A DNA template which is a double-stranded DNA that needs to be amplified.
  2. Primers are small chemically made oligonucleotides of about 10-18 nucleotides that are complementary to a region of template DNA.
  3. Enzymes used are Taq polymerase (from Thermus aquaticus) and the vent polymerase (from Thermococcus litoralis).

ii) Steps in PCR :

  1. Denaturation of double-stranded DNA is carried out by applying high temperature of 95°C for 15 seconds. Each separated single-stranded strand acts as a template for DNA synthesis.
  2. Annaling is carried out in two sets of primers. Which are added and anneal to the 3′ end of each separated strand. Primers act as initiator of replication.
  3. Extension is done by DNA polymerase of primers by adding nucleotides complementary to the template provided in the reaction.
  4. A thermostable DNA polymerase (taq polymerase) is used in the reaction which can tolerate the high temperature of the reaction.
  5. These steps are repeated many times to obtain several copies of desired DNA.

d) Ligation of the DNA fragment into a vector requires a vector DNA and source DNA.

  1. These are cut with the same endonuclease to obtain sticky ends.
  2. Both are then ligated by mixing vector DNA, gene of interest and enzyme DNA ligase to form recombinant DNA.

TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology Principles and Processes 3

e) Insertion of recombinant DNA into the host cell :
Organism occurs by several methods, before which the recipient cells are made competent to receive the DNA.

  1. If recombinant DNA carrying antibiotic resistance (eg., ampjcillin) is transferred into E.coli cells, the host cell is transformed into ampicillin resistant cells
  2. The ampicillin resistant gene can be called as selectable marker.
  3. When transformed cells are grown on agar plates containing ampicillin, only transformants will grow and other will die.

f) Culturing the host cells in a medium at a large scale :
It is carried out in appropriate medium at optimal conditions. The DNA gets multiplied and express itself to form desired products.

g) Extraction of desired gene products :
It is carried out by following steps.

  1. A protein encoded gene expressed in a heterologous host is called recombinant protein.
  2. Cells having genes of interest can be grown on a small scale or on a large scale.
  3. In small scale cells are grown on cultures and then expressed protein is extracted and purified by various separation methods.
  4. In large scale cells are grown in a continuous culture system in which fresh medium is added from one side to maintain cells growth phase and the desired protein is collected from the other side.

TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology: Principles and Processes

Question 2.
Give a brief account of the tools of recombinant DNA technology. [March 2020, March 2019, May 2017]
Answer:
The tools of recombinant DNA technology
i) Restriction enzymes
ii) Polymerase enzymes
iii) Ligases
iv) Vectors
v) Host organism

i) Restriction enzymes :
Belong to a larger class or enzymes called Nucleases. These are two kinds.
a) Exonucleases :
Exonucleases remove nucleotides from the ends of the DNA.

b) Endonucleases :
Endonucleases make cuts at specific positions with in the DNA. Restriction enzymes cut the strand of DNA a little away from the centre of the palindrome sites, but between the same two bases on the opposite strands.
Eg : EcoRI recognises 5′ GAATTC 3′ sites on the DNA and cuts in between G and A.
TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology Principles and Processes 4

Naming of Restriction Enzymes :

  • The first letter of the name comes from the genus and the next two letters from the name of the species of the prokaryotic cell from which it is isolated.
  • The next letter comes from the strain of the prokaryote.
  • The Roman numbers following these four letters indicate the order in which the enzymes were isolated from that strain of the bacterium.
    Eg: EcoRI from Escherichia coli RY13
    Hind II is from Haemophilus influenzae
    Bam HI is from Bacillus amyloliquefaciens

ii) Polymerase enzymes :
Thermas aquaticus a bacterium yields DNA polymerase used in biotechnology.

  1. This enzyme remains active during the high temperature applied during denaturation of double-stranded DNA.
  2. It extends the primers using the nucleotides provided in the reaction and the genomic DNA as template.
  3. Repeated amplification is achieved by this enzyme. The amplified fragments, if desired can be used to ligate with a vector for further cloning.

iii) Ligases :
The enzyme DNA ligase joins the complementary ends of the plasmid DNA with that of desired gene by covalent bonding to regenerate a circular hybrid called Recombinant (r) DNA or chimeric DNA.

iv) Vectors :
The DNA used as a carrier for transferring a fragment of foreign DNA into a suitable host called vector.

Vectors used for multiplying the foreign DNA sequence are called cloning vectors. Commonly used vectors are plasmids, bacteriophages, cosmids.

Properties of cloning vector

  1. It must have low molecular weight.
  2. It must have unique cleavage site for the activity of restriction enzymes at single point.
  3. It must be able to replicate inside the host cell after its introduction (through ori gene – origin of replication).
  4. The vectors requires a selectable marker, which helps in identifying and eliminating non transformants and selectively permitting the growth of transformants.

v) Host organisms :
Competent host for transformation with Recombinant DNA is required as tool.

Intext Question Answers

Question 1.
Do eukaryotic cells have restriction endonucleases? Justify your answer.
Answer:
No, eukaryotic cells do not have restriction endonucleases. This is because the DNA of eukaryotes is highly methylated by a modification enzyme called m&thylase. Methylation protects the DNA from the activity of restriction enzymes. These enzymes are present in prokaryotic cells were they help prevent the invasion of DNA by virus.

Question 2.
Besides better aeration and mixing properties, what other advantages do stirred tank bioreactors have over shake flasks?
Answer:
The shake flask method is used for a small scale production of biotechnological products in a laboratory. On the other hand, stirred tank bioreactors are used for a large scale production of the biotechnology products stirred tank bioreactors have several advantages over shake flasks.

  1. Small volumes of culture can be taken out from the reactor for sampling or testing.
  2. It has a foam breaker for regulating the foam.
  3. It has a control system that regulates the temperature and pH.

Question 3.
Can you recall meiosis and indicate at what stage a recombinant DNA is made?
Answer:
Meiosis is a process that involves the reduction in the amount of genetic material. It is two types, namely meiosis I and meiosis II. During the pachytene stage of prophase I, crossing over of chromosomes takes place where the exchange of segments between non-sister chromatids of homologous chromosomes takes place. This results in the formation of recombinant DNA.

Question 4.
Describe briefly the following :
a) Origin of replication
b) Bioreactors
c) Downstream processing
Answer:
a) Origin of replication :
Origin of replication is defined as the DNA sequence in a genome from where replication initiates. The initiation of replication can be either uni-directional or bi-directional. A protein complex recognizes the ‘on’ site, unwinds the two strands and initiates the copying of the DNA.

b) Bioreactors :
Bioreactors are large vessels used for the large scale production of biotechnology products from raw materials. They provide optimal conditions to obtain the desired product by providing the optimum temperature, pH, vitamin, oxygen, etc. Bioreactors have an oxygen delivery system, a foam control system, a pH, a temperature control system, and a sampling port to obtain a small volume of culture for sampling.

c) Downstream processing :
Downstream processing is a method of separation and purification of foreign gene products after the completion of the biosynthetic stage. The product is subjected to various processes in order to separate and purify the product. After downstream processing, the product is formulated and is passed through various clinical trails for quantity control and other test.

TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology: Principles and Processes

Question 5.
Explain briefly
a) PCR
b) Restriction enzymes and DNA
c) Chitinase
Answer:
a) PCR :
PCR stands for Polymerase Chain Reaction. In this reaction, multiple copies of the gene (or DNA) of interest are synthesised in vitro using two sets of primers and the enzyme DNA polymerase.

b) Restriction enzymes and DNA :
It is also called as molecular scissors. It belongs to class of enzyme called nucleases. It always cut DNA molecules at a particular point by recognizing a specific sequence of six base pairs known as recognition sequence. DNA : DNA stands for Deoxyribo Nucleic Acid. It is a double stranded molecule. It contains deoxyribose sugar. It has the ability to replicate. It is a component of the chromosome.

c) Chitinase :
Chitinase is a class of enzymes used for the degradation of chitin, which forms a major component of the fungal cell wall. Therefore, to isolate the DNA enclosed within the cell membrane of the fungus, enzyme chitinase, is used to break the cell for releasing its genetic material.

Question 6.
Discuss with your teacher and find out how to distinguish between
a) Plasmid DNA and Chromosomal DNA
b) RNA and DNA
c) Exonuclease and Endonuclease
Answer:
a) Plasmid DNA and Chromosomal DNA :

Plasmid DNAChromosomal DNA
Plasmid DNA is an extra-chromosomal DNA molecule in bacteria that is capable of replicating, independent of chromosomal DNA.Chromosomal DNA is the entire DNA of an organism present inside chromosomes.

b) RNA and DNA :

RNADNA
1) RNA is single stranded molecule.1) DNA is a double stranded molecule.
2) It contains ribose sugar.2) It contains deoxyribose sugar.
3) The pyramidines in RNA are Adenine and Uracil.3) The pyramidines in DNA are Adenine and Thymine.
4) RNA cannot replicate itself.4) DNA molecules have the ability to replicate.
5) It is a component of the ribosome.5) It is a component of the chromosomes.

c) Exonuclease and Endonuclease :

ExonucleaseEndonuclease
It is a type of restriction enzyme that removes the nucleotide from 5′ or 3′ ends of the DNA molecule.It is a type of restriction enzyme that makes a cut within the DNA at a specific site to generate sticky ends.

TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology: Principles and Processes

Question 7.
What does ‘H’ in’d’ and ‘III refer to in. the enzyme Hind III?
Answer:
In naming restriction enzymes, the first letter comes from the genus Haemophilus (H)
The next two letters comes from the name of the species influenzae (in).
The next letter comes from the strain of the prokaryote (d).
The Roman numbers following these four letters indicate the order in which the enzymes were isolated from that strain of the bacterium.

Question 8.
Restriction enzymes should not have more than one site of action in the cloning site of a vector. Comment.
Answer:
Cloning sites are required to link alien DNA with vector.

  1. For this, the vector requires single recognition sites forthe commonly used restriction enzymes.
  2. Presence of more than one restriction sites within the vector will generate several fragments leading to complication to gene cloning.

Question 9.
What does ‘competent’ refer to in ‘competent cells’ used in transformation experiments?
Answer:
Since DNA is a hydrophillic molecule, it cannot pass through cell membranes. In order to force bacteria to take up the plasmid, the bacterial cells must first be made competent to take up DNA. This is done by treating them with a specific concentration of a divalent cation, such as calcium, which increases the efficiency with which DNA enters the bacterium through pores in its cell wall.

Question 10.
What is the significance of adding proteases at the time of isolation of genetic material (DNA).
Answer:
Proteins can be removed by treating them with proteases at the time of isolation of genetic material (DNA).

Question 11.
While doing a PCR, ‘denaturation’ step is missed. What will be its effect on the process?
Answer:
Annealing and Extensions and amplifing does not takes place.

Question 12.
What modification is done on the Ti plasmid of Agrobacterium tumefaciens to convert it into a cloning vector?
Answer:
Agrobacterium tumefaciens, a pathogen of several dicot plants is able to deliver a piece of DNA known as T-DNA to transform normal plant cells into tumor and directs these tumor cells to produce the chemicals required by the pathogens. The tumor inducing (Ti) plasmids of Agrobacterium tumifaciens has now been modified into a cloning vector such that it is no longer pathogenic to plants but it still able to use the mechanisms to deliver genes of our interest into a variety of plants.

TS Inter 2nd Year Botany Study Material Chapter 11 Biotechnology: Principles and Processes

Question 13.
What is meant by gene cloning?
Answer:
The selected fragments of DNA are inserted into a suitable vector to produce a large number of copies of genes. This is called gene cloning.

Question 14.
Decide the ratio between ester bonds and hydrogen bonds that are broken in each palindromic sequence of a DNA when treated with EcoRI during the formation of sticky ends.
Answer:
Equal ratio 2 : 8, i.e 1: 4.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Telangana TSBIEĀ TS Inter 2nd Year Botany Study Material 10th Lesson Molecular Basis of Inheritance Textbook Questions and Answers.

TS Inter 2nd Year Botany Study Material 10th Lesson Molecular Basis of Inheritance

Very Short Answer Type Questions

Question 1.
What is the function of histones in DNA packaging?
Answer:

  1. Histones are positively charged basic proteins. They are organized to form a unit of eight molecules called histone octamer.
  2. The negatively charged DNA is wrapped around the positively charged histone octamer to form a structure called nucleOsome.

Question 2.
Distinguish between heterochromatin and euchromatin. Which of the two is transcriptionally active? [Mar. 2020]
Answer:
1. Euchromation :
Regions of chromatin that are loosely packed and stained lightly. It is transcriptionally active.

2. Heterochromation :
Regions of chromatin that are densely packed and stained dark. It is transcriptionally inactive.

Question 3.
Who proved that DNA is genetic material? What is the organism they worked on? [May 2017]
Answer:

  1. Alfred Hershey and Martha Chase proved that DNA is genetic material.
  2. They worked with viruses that infect bacteria, bacteriophages.

Question 4.
What is the function of DNA polymerase?
Answer:

  1. DNA polymerase uses a DNA template to catalyze polymerization of deoxynucleotides.
  2. It is highly efficient and catalyses polymerization in only one direction (5′ → 3′) with high degree of accuracy.

Question 5.
What are the components of a nucleotide? [Mar. ’18, ’17; May ’14]
Answer:

  1. A pentose sugar, a phosphate group and a nitrogen base are the 3 components of a nucleotide.
  2. The pentose sugar is ribose in nucleotides of RNA and it is deoxyribose in nucleotides of DNA.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 6.
Write the structure of chromatin.
Answer:

  1. Nucleosomes are formed due to wrapping of negatively charged DNA around the positively charged Histone octamers. These repeating units in the nucleus form chromatin.
  2. The nucleosomes in chromatin are seen as ‘beads – on – string’.

Question 7.
What is the cause of discontinuous synthesis of DNA on one of its parental strands? What happens to these short stretches of synthesised DNA?
Answer:

  1. The DNA – dependent DNA polymerase can catalyze polymerization in only one direction, 5′ → 3′ and hence DNA synthesis is discontinuous on lagging of strand (with 5′ → 3′ polarity) of parental DNA.
  2. The discontinuously synthesized Okazaki fragments on lagging strand are later joined by DNA ligase to form a continuous strand.

Question 8.
Given below is the sequence of coding strand of DNA in a transcription unit 3′ – AATGCAGCTATTAGG – 5′
Write the sequence of
a) its complementary strand
b) the mRNA
Answer:
a) Its complementary strand
5′ – TTACGTCGATAATCC – 3′

b) The mRNA
5′- UUACGUCGAUAAUCC – 3′

Question 9.
In a nucleus, the number of ribonucleoside triphosphates is 10 times the number of deoxy ribonucleoside triphosphates, but only deoxyribonucleotides are addded during the DNA replication. Suggest a mechanism.
Answer:

  1. DNA is a polymer made of deoxyribonucleotides.
  2. Absence of 2 – OH group is nuclosides confers stability to DNA molecules.

Question 10.
Name any three viruses which have RNA as the genetic material.
Answer:

  1. Tobacco Mosaic virus
  2. Polio virus
  3. HIV
  4. QB Bacteriophage

Question 11.
Write the sequence of nucleotides after single base insertion and deletion in the given gene:
Gene: THE CAT ATE THE FAT RAT
Answer:
1. If single base T is inserted between ‘THE’ and ‘CAT’, then
Gene : THE TCA TAT ETH EFA TRA T

2. If single base C is deleted from ‘CAT’, then
Gene: THE ATA TET HEF ATR AT

Question 12.
Why was DNA chosen over RNA as genetic material in the majority of the organisms?
Answer:

  1. RNA consists of 2 – OH’ group at every nucleotide which is reactive group and makes RNA liable and eassily degradable. It is single stranded, catalyst, reactive and hence unstable.
  2. DNA lacks 2 – OH’ group, double stranded, consists of thymine and resists changes by evolving a process of repair. Hence it is a stable genetic material in majority of the organisms.

Question 13.
What are the components of a transcription unit? [March 2019]
Answer:
The three major components of a transcription unit are (1) A Promoter (2) The structural gene (3) A terminator.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 14.
What is the difference between exons and introns?
Answer:
1. Exons :
The coding (expressed sequences in split genes of eukaryotes and will appear in processed (matured) RNA.

2. Introns :
The non coding sequences in split genes of eukaryotes that interrupt introns and they do not appear in processed RNA.

Question 15.
What is meant by capping and tailing? [May 2017]
Answer:
1. Capping :
It is a process in which, an unusual nucleotide (methyl guanosine triphosphate) is added to the 5′ end of hn RNA.

2. Tailing :
In this process, adenylate residues (200 – 300) are added at 3′ – end in a template independent manner.

Question 16.
What is meant by point mutation? Give an example. [May 2014]
Answer:

  1. The mutation that occurs in a single base pair of a gene is called point (gene) mutation.
  2. A point mutation in the gene for Beta globin chain (in human haemoglobin) results a disease, sickle cell anaemia.

Question 17.
Define peptide bond. Why are proteins referred to as polypeptide chains?
Answer:

  1. The bond between two adjacent amino acids in a protein is known as peptide bond.
  2. Proteins are the macromolecules and polymers. Amino acids, are joined by many peptide bonds to form proteins and hence are referred as polypeptide chains.

Question 18.
What is meant by charging of tRNA?
Answer:

  1. Charging of tRNA (amino acylation of tRNA): Amino acids are activated in the presence of ATP and linked to their cognate tRNAs.
  2. This favours the formation of peptide bond by providing energy.

Question 19.
What is a regulator and a promoter?
Answer:

  1. Regulator : This gene directs the activity of the operator gene by producing an inhibitor protein called repressor.
  2. Promoter is a region of DNA where RNA polymerase binds and initiates transcription.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 20.
During DNA replication, why is it that the entire molecule does not open in one go? Explain replication fork.
Answer:

  1. For long DNA molecules, the entire molecule does not open in one go due to very high energy requirement.
  2. The replication occur within a small opening of the DNA helix referred to as replication fork. This is the Y-shaped structure formed when the double-stranded DNA is unwounded upto a point during its replication.

Question 21.
What is the function of the codon-AUG? [Mar. ’20, ’14]
Answer:

  1. AUG acts as the initiation codon (start codon) during formation of mRNA.
  2. It also codes for an aminoacid, Methionine.

Question 22.
Define stop codon. Write the codons. [March 2019]
Answer:

  1. The codons that do not code for any amino acid and responsible for termination of protein synthesis / translation process are called as stop codons.
  2. There are 3 stop codons ie., UAA, UAG and UGA.

Question 23.
What is the difference between the template strand and a coding strand in a DNA molecule? [May 2014]
Answer:

Template strandCoding strand
1) The strand with 3′ → 5′ polarity is a replicating DNA.1) It is a strand with 5′ → 3′ polarity in a replicating DNA.
2) This consists of structural gene flanked by promoter and terminator sequences respected at 3′ and 5′ ends.2) It has terminator towards 3′ end.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 24
Write any two chemical differences between DNA and RNA. [March 2017]
Answer:

DNARNA
1) DNA has deoxyribose sugar.1) RNA has Ribose sugar.
2) It has thymine and cytosine as pyrimidine bases.2) It has uracil and cytosine as pyramidine base.

Question 25.
In a typical DNA molecule, the proportion of Thymine is 30% of the N bases. Find out the percentages of other N bases.
Answer:

  1. According to Erwin Chargaff in double stranded DNA the ratio between A and T and between G and C are constant and each equals one.
  2. Adenine – 30%, Guanine – 20%, Cytocine – 20%.

Question 26.
The proportion of nucleotides in a given nucleic acid are: Adenine 18%, Guanine 30%, Cytosine 42%, and Uracil 10%. Name the nucleic acid and mention the number of strands in it. [March 2018]
Answer:

  1. As there is Uracil (pyramidine) is the given problem the nucleic acid is RNA.
  2. The proportion of A ≠ U and G ≠ C, so it is single stranded RNA.

Question 27.
If the base sequence of a codon in mRNA is 5′ AUG-3′. What is the sequence of tRNA pairing with it?
Answer:
3′ – UAC – 5′

Short Answer Type Questions

Question 1.
Define transformation in Griffith’s experiment. Discuss how it helps in the identification of DNA as genetic material.
Answer:
Transformation is defined as the uptake of a naked DNA molecule of the fragments of a bacterial cell and the incorporation of this DNA molecule into the recepient chromosome in a heritable form.

In 1928 Frederick Griffith performed the experiments on Bacterial transformation with Streptococcus pneumonia the bacterium causing pneumonia. During the course of his experiment he found that a living organism (bacteria) could change in physical form.

  • He observed two strains of this bacterium, one forming smooth colonies with capsule (S-type) and the other forming rough colonies without capsule (R-type).
  • The S-type cells are virulent while R-type cells are non-virulent.
  • When live S-type cells are injected into the mice, they suffered from pneumonia and died.
  • When live R-type cells are injected into the mice, the disease did not appear and the mice survived.
  • When heat killed S-type cells were injected, the disease did not appear.
  • When heat killed S-type were mixed with live R-type cells and injected into the mice, the mice died of pneumonia and live S-type cells were isolated from the body of mice.
  • He concluded that the R-strain had some how been transformed by the heat killed S- strain bacteria, which must be due to the transfer of genetic material the transforming principle.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 2.
Who revealed the biochemical nature of the transforming principle? How was it . done? Oswald Avery, Colin Mac Lead, and Madyn Me carty.
Answer:
Avery Mac Lead and Me carty revealed the biochemical nature of the transforming principle in a Griffith experiment.

  • They purified biochemicals like proteins, DNA and RNA from the heat killed S-cells to see which one could transform live R cells into S cells.
  • When their fraction were added to the culture of live R-cells, DNA was able to cause transformation of R-cells into S-cells.
  • They also found that protein digesting enzymes and RNA digesting enzymes did not affect transformation indicating that transforming substance is not a protein or RNA.
  • Digestion with DNase did inhibit transformation, this suggests that the DNA cause transformation.

Question 3.
Discuss the significance of heavy isotope of nitrogen in Meselson and Stahl’s experiment.
Answer:
a) Matchew Meselson and Franklin Stahl performed an experiment using Escherischia coli to prove that DNA replication is semi conservative.

b) They grew E.coli in a medium containing 15NH4Cl (15N is the heavy isotope of nitrogen) as the only nitrogen source for many generations. This heavy DNA can be separated from the normal DNA by centrifugation in Cesium Chloride (CsCl) density gradient (Note that 15N is not a radioactive isotope and it can be separated from 14N based on densities only).

c) Then they transferred the cells into a medium with normal 14NH4Cl and took out samples at various time intervals and extracted DNA and centrifuged them to measure their densities.

d) Thus the DNA that was extracted from the culture one generation after transfer from 15N to 14N medium (that is after 20 minutes: E.coli divides in 20 minutes) had a hybrid or intermediate density.

e) The DNA extracted after two generations (i.e., after 40 minutes) consisted of equal amounts of light DNA and hyrbid DNA.
TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 1

Question 4.
Define a cistron. Differentiate between monocistronic and polycistronic transcription unit with suitable examples. [May 2014]
Answer:
Cistron is defined as a segment of DNA coding for a polypeptide.

Monocistronic transcription :
Mostly in eukaryotes. The structural gene only one transcription unit can translate only one protein chain (or) one polypeptide chain. So it be said to be monocistronic transcription.

Polycistronic transcription:
Mostly in prokaryotes. The structural gene in a transcription unit can translate many polypeptides be said to be polycistronic transcription.

Question 5.
Recall the experiments done by Frederick Griffith in which DNA was speculated to be the genetic material. If RNA, instead of DNA, was the genetic material, would the heat killed strain of Pneumococcus have transformed the R-strain into virulent strain? Explain.
Answer:

  1. Stability as one of the properties of genetic material was clearly evident in Griffith’s transforming principle.
  2. Heat which killed bacteria, at least did not destroy some properties of genetic material.
  3. This can be explained by DNA. The two strands, being complementary, if separated by heating, come together when appropriate conditions are provided.
  4. RNA is has 2′ – OH group present at every nucleotide. It make RNA labile and easily degradable, RNA is reactive.
  5. RNA cannot be genetic material as RNA is degradable to heat, it cannot transform R strain into virulent strain.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 6.
There is only one possible sequence of amino acids when deduced from a given nucleotides. But a multiple nucleotide sequence can be deduced from a single amino acid sequence. Explain this phenomenon.
Answer:
AUG UUU UUC UUC UUU UUU UUC the only possible sequence of amino acid is
Met Phe Phe Phe Phe Phe Phe

Similarly from the sequence of following amino acids coded by an mRNA. Met-Phe-Phe-Phe-Phe-Phe-Phe the nucleotide sequence may be any one of UUU or UUC because these two codon code for Phenylalanine (Phe). As there are 64 codons for 20 amino acid and in which 3 codon do not code for any amino acids. Remaining codons must code for 20 amino acids. Therefore there will be more nucleotide for a single amino acid.

Question 7.
A single base mutation in a gene may not always result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Answer:
No, the statement is not correct.

A classical example of point mutation is a change of single base pair in a gene for beta globin chain (in human haemoglobin) that results in the change of amino acid residue glutamate to valine. It results in a diseased condition called sickle cell anemia.

Thus a change in a single nucleotide in a codon alters the amino acid in a polypeptide chain.

For example :
Consider a statement that is made up of following words each having three letters like a genetic code.
RAM HAS RED CAP

If we insert a letter B in between HAS and RED and rearrange the statement it would read as follows.
RAM HAS BRE DCA P

The same can be repeated by deleting the one letter R then it will be the statement to make a triplet word.
RAM HAS EDC AP

Insertion or deletion of one or two bases changes the reading frame from the point of insertion or deletion. It can disrupt the protein structure and affect the functioning.

Question 8.
A low level of expression of lac operon occurs all the time. Can you explain the logic behind this phenomenon.
Answer:

  • In lac operon (here lac refers to lactose), a polycistronic structural gene is regulated by a common promoter and regulatory genes. Such an arrangement is very common in bacteria and is referred to as operon.
  • Lactose is the substrate for the enzyme beta-galactosidase and it regulates switching on and off of the operon. Hence it is termed as inducer.
  • In the absence of a preferred carbon source such as glucose, if lactose is provided in the growth medium of the bacteria. It is transported into the cells through the action of permease.
  • A very low level of expression of lac operon has to be present in the cell all the time, otherwise, lactose cannot enter the cells.

Question 9.
What background information did Watson and Crick have for developing a model of DNA? What was their contribution?
Answer:
Background information for developing a model of DNA was : DNA as an acidic substance present in the nucleus was first identified by Friedrich Meischer in 1869. He named it “Nuclein”. However, due to technical limitation in isolating such a long polymer intact, the elucidation of structure of DNA remained elusive for a long period of time.

It was in 1953 that James Watson and Francis Crick, based on the X-ray diffraction data produced by Maurice Wilkins and Rosalind Franklin, proposed a very simple and famous Double Helix model for the structure of DNA.

One of the hallmarks of their proposition was base pairing between the two strands of polynucleotide chains. However, this proposition was also based on the observation of Erwin Chargaff that for a double stranded DNA, the ratio between Adenine and Thymine and that between Guanine and Cytosine are constant and each equal ones.

Question 10.
What are the functions of
i) methylated guanosine cap,
ii) poly-A “tail” in a mature on RNA?
Answer:i) In capping and unusual nucleotide (methylated guanosine cap) is added to the 5′ end of hn RNA.

ii) In tailing, adenylate (Poly-A-tail) residues are added at 3’ end in the template independent manner. It is a fully processed hn RNA, now called mRNA.

Question 11.
How many types of RNA polymerases exist in cells? Write their names and functions.
Answer:
There are 3 types of RNA polymerases in the nucleus (in addition to the RNA polymerase found in the organelles).
They are

  1. RNA polymerase I transcribes rRNAs (28s, 18s & 5.8s)
  2. RNA polymerase II transcribes the precursor of mRNA, the heterogenous nuclear RNA (hn RNA).
  3. RNA polymerase III. It is responsible for transcription of tRNA < 5sr RNA and sn RNAs (Small nuclear RNAs).

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 12.
Write briefly about DNA polymerase.
Answer:
DNA polymerase is the main enzyme in the replication of DNA.

It uses a DNA template to catalyse the polymerisation of deoxynucleotides only, in one direction i.e., 5′ → 3′ leading to one strand replication continuous and the other one as discontinuous.

The DNA polymerase can not initiate the process of replication on their own. A small stretch of RNA (called a primer) is required for initiation.

Question 13.
What are the contributions of George Gamow, H.G. Khorana, Marshall Nirenberg in deciphering the genetic code?
Answer:
George Gamow, a physicist argued that since there are only 4 bases and if they have to code for 20 amino acids, the code should constitute a combination of bases. He suggested that in order to code for all the 20 amino acids, the code should be made up of three nucleotides. This was a bold proposition, because a permutation and combination of 43 (4 Ɨ 4 Ɨ 4) would generate 64 codons, generating more codons than required.

Har Gobind Khorana developed a chemical method in synthesising RNA molecules with defined combinations of bases (homopolymers such as UUU and copolymers such as UUC, CCA).

Marshall Nirenberg’s made cell free system for protein synthesis. It finally helped the code to be deciphered.

Question 14.
On the diagram of the secondary structure of tRNA shown below indicate the location of the following features :
a) Anticodon b) Acceptor stem c) Anticodon stem d) 5′ end e) 3′ end
TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 2
Answer:
TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 3

Question 15.
If there are 2.9 Ɨ 109 complete turns in a DNA molecule estimate the length of the molecule.
(1 angstrom = 10-8 cm).
Answer:
Distance between two consecutive base pair is 0.34 nm (0.34 Ɨ 10-9 m)
Complete turns in DNA = 2.9 Ɨ 109
Length of the DNA = Total no. of multiply with distance
between two consecutive bp = 2.9 Ɨ 109 Ɨ 0.34 Ɨ 10-9 = 0.986 m

Question 16.
Draw the schematic / diagrammatic presentation of the lac operon.
Answer:
TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 4

Question 17.
What are the differences between DNA and RNA? [March ’20, ’14]
Answer:

DNARNA
1. It has two strands of nucleotides.1. It has only one strand of nucleotides.
2. Most of the DNA is present in the nucleus and very little in chloroplast and mitochondria.2. Most of the RNA is present in cytoplasm and little in the nucleus.
3. Deoxyribose sugar is present (C5H10O4).3. Ribose sugar is present (C5H10O5).
4. Pyrimidines are Thymine and Cytosine.4. Pyrimidines are Uracil and Cytosine.
5. DNA is made up of several nucleotides (more than 4 millions).5. RNA is made up of few nucleotides (75 – 2000 or more in mRNA).
6. DNA undergoes self replication.6. Does not undergo self replication except in RNA viruses.
7. DNA is the genetic material.7. RNA is non-genetic material (except in . RNA viruses).
8. DNA does not participate directly in protein synthesis.8. RNA participates directly in protein synthesis.
9. Metabolically DNA is of one type.9. Metabolically RNA is of three types.
10. The base pairing is A = T and G ≔ C10. The base pairing is A = U and G ≔ C.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 18.
Write the important features of Genetic code. [Mar. 18, 17]
Answer:
The important features of Genetic code are

  1. The codon is Triplet. 61 codons code for amino acids and 3 codons do not code for any amino acids, hence they function as stop codons.
  2. One codon codes for only one amino acid, hence it is unambiguous and specific.
  3. Some amino acids are coded by more than one codon, hence the code is degenerate.
  4. The codon is read in mRNA in a contiguous fashion. There are no punctuations.
  5. The code is nearly universal. For example, from bacteria to human, UUU would code for pheylalaline (Phe). Some exceptions to this rule have been found in mitochondrial codons, and in some protozoans.
  6. AUG has dual functions. It codes for Methionine (Met) and also acts as the initiotor codon.

Question 19.
Describe the sequential steps in the replication of a DNA molecule.
Answer:

  • The process of replication involves a number of enzymes / catalysts of which DNA- dependent DNA-polymerase, is the major enzyme. It catalyses the polymerisation of the deoxy-ribonucleotides approximately at a rate of 2000 bs/second.
  • The interwined DNA strand start separating from a particular point called origin of replication (which is single is prokaryotes and many in eukaryotes).
  • This unwinding is catalysed by enzymes called helicases.
  • Enzymes called topoisomerases break and reseal one of the strands of DNA, so that the unwind strands will not wind back.
  • It is easy to add the base onto an already existing chain called primer.
  • Primer is a short strech of RNA formed on the DNA template catalysed by enzyme primase.
  • When a double stranded DNA is unwind upto a point, it shows a Y-shaped structure called replication fork.
  • As new strands grow from the fork, it appears as if the point of divergence at the fork is moving.
  • Enzyme DNA polymerase catalyses the joining of nucleotides (A, T, G, C) in the 5′ → 3′ direction.
  • The enzymes forms one new strand in a continuous stretch (leading strand) in the 5′ → 3′ direction, on one of the template strands.
  • On the other template strand, the enzyme forms short stretches of DNA (Okazaki fragments) also in the 5′ → 3′ direction.
  • The Okazaki fragments are later joined by DNA – ligase to form the lagging strand.
  • In prokaryotes, the DNA-polymerase does proof reading by removing any wrong base added, before proceeding to add new bases.
  • The two strands are held together by hydrogen bonds between nucleotides.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 5

Question 20.
Give a diagrammatic presentation of the process of transcription in a bacterial cell.
Answer:
TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 6

Question 21.
Write briefly on nudeosomes. [Mar. 2019, May ’17]
Answer:
TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 7
In DNA of eukaryotes, there are a set of positively charged basic proteins called histones.

  • Histones are organised to form a unit of eight molecules called histone octamer.
  • The negative charged DNA is wrapped around the positively charged histone octamer to form a structure called nudeosome.
  • A typical nucleosome contains 200 bp of DNA helix.
  • Nucleosome constitute the repeating unit of a structure in nucleus called chromatin.
  • The nudeosomes in chromatin are seen as “beads-on-string” when viewed under electron microscope.

Long Answer Type Questions

Question 1.
Give an account of the Hershey and Chase experiment. What did it conclusively prove? If both DNA and proteins contained phosphorus and sulphur do you think the result would have been the same.
Answer:
Harshey and Chase Experiment:

  • Their experiment is to prove that DNA is the genetic material and not the protein.
    TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 8
  • They worked with bacteriophage T2 which attacks bacterium E.coli.
  • The grew some viruses on the medium that contained radioactive phosphorus and some others on a medium that contained radioactive sulphur.
  • Virus grown in the presence of radioactive phosphorus contained radioactive DNA but not radioactive protein because DNA contains phosphorus but protein does not.
  • Similarly, virus, grown on radioactive sulphur contained radioactive protein but not radioactive DNA because DNA does not contain sulphur.
  • Radioactive phages were allowed to attach to E.coli bacteria.
  • The infection proceeded, the viral coats were removed from the bacteria by agitating them in a blender. The virus particles were separated from the bacteria by spinning them in a centrifuge.
  • Bacteria which were infected with viruses that had radioactive DNA were radioactive, indicating that DNA was the material that passed from the virus to the bacteria.
  • Bacteria that were infected with viruses that had radioactive proteins were not radioactive.
  • This indicates that proteins did not enter the bacteria from the viruses.
  • Thus it proves that DNA is the genetic material that is passed from virus to bacteria.
  • If both DNA and proteins contained phosphorus and sulphur the result would not be same.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 2.
Give an account of post transcriptional modifications of a eukaryotic mRNA.
Answer:

  • The primary transcripts contain both exons and introns and they are non-functional. Hence they are subjected to a process called splicing where the introns are removed and exons are joined in a defined order.
    TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 9
  • hn RNA undergoes additional processing called capping and tailing, ft In capping an unusual nucleotide (methyl guanosine triphosphate) is added to the 5′ end of hn RNA.
  • In tailing, adenylate residues (200-300) are added at 3′ end in a template independent manner.
  • It is the fully processed hn RNA, now called mRNA, that is transported out of the nucleus for translation.

Question 3.
Discuss the process of translation in detail.
Answer:
Translation is the process of polymerization of amino acids to form a polypeptide.
i) The amino acids are joined by a bond which is known as a peptide bond. This process requires energy.
ii) The different phases of translation are
a) Activation of amino acids
b) Initiation of polypeptide synthesis
c) Elongation of polypeptide chain
d) Termination of polypeptide chain

a) Activation of amino acids :
It occur in presence of ATP and linked to their cognate tRNA i.e., charging of tRNA or aminoacylation of tRNA. If two such charged tRNA, are brought close, the formation of peptide bond between them would occur energitically in presence of a catalyst.

b) Initiation of polypeptide synthesis occurs in ribosomes (cellular factory for protein synthesis):

  1. Ribosome consists of structural RNAs and about 80 different proteins.
  2. In its inactive state, it exists as two subunits – a large and a small subunit.
  3. When the small subunit encounters an mRNA, the process of translation of the mRNA to protein begins P-site and A-site.
  4. There are two sites in the large subunits – the P-site and A-site for subsequent aminoacids to bind to and thus close enough to each other for the formation of a peptide bond.
  5. The small subunit attaches to the large subunit in such a way that the initiation (AUG) comes to the P-site.

Elongation of polypeptide chain :
When a second tRNA charged with an appropriate amino acid binds to the A-site of the ribosome.
i) The peptide bond (CO – NH) forms between the carboxyl group of methionine and the amino group of the second amino acid. The reaction is catalysed by the enzyme peptidyl transferase.

ii) The complexes composed of an amino acid linked to tRNA, sequentially bind to the appropriate codon in mRNA by forming complementary base pairs with the tRNA anticodon.

iii) The ribosome moves from codon to codon along with the mRNA. Amino acids are added one by one, translated into polypeptide sequence dictated by DNA and represented by mRNA.

Termination of polypeptide synthesis occur when a released factor binds to the stop codon. As a result, the polypeptide synthesis or elongation stops releasing the complete polypeptide from the ribosome.
TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 10

Question 4.
Write briefly about Griffith’s experiments on S. pneumoniae bacteria. What was his conclusion?
Answer:
Frederick Griffith (1928) performed the experiments on Bacterial transformation with Streptococcus pneumoniae, the bacterium causing pneumonia.

  • He observed two strains of this bacterium, one forming smooth colonies with capsule (S-type) and the other forming rough colonies without capsule (R-type).
  • The S-type cells are virulent while the R-type cells are non-virulent.
  • When live S-type cells were injected into the mice, they suffered from pneumonia and died.
  • When live R-type cells were injected into the mice, the disease did not appear and the mice survived.
  • When heat killed S-type cells were injected, the disease did not appear.
  • When heat killed S-type cells were mixed with live R-type cells and injected into the mice, the mice died of pneumonia and live S-type cells were isolated from the body of the mice.
  • He concluded that the R-strain had somehow been transformed by the heat killed S-strain bacteria, which must be due to transfer of genetic material, the transforming principle.

Question 5.
Define an operon, giving an example. Explain what is an Inducible operon.
Answer:
Operon is a group of closely packed structural genes and regulatory elements (DNA sequences) such as a regulator, a promoter and an operator, which function in a coordinated manner.
F. Jacob and J. Monod were first described a transcriptionally regulated system.

The lac operon (here lac refers to lactose) consists of one regulatory gene (i gene), the promoter (p) and operator (o) and the structural genes (z, y and a).
i) i – codes for repressor of the operon
z – codes for beta galactosidase (β-gal) y – codes for enzyme permease
a – codes for transacetylase enzyme ā€˜

ii) All the three gene products in lac operon are required for metabolism of lactose.
TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 11
iii) Lactose is the substrate for the enzyme betagalactosidase and its regulates switching on and off of the operon. Hence it is termed as inducer.

iv) The lactose induces operon in the following way.
a) Repressor of the operon is synthesized from the i-gene.
b) Repressor protein binds to the operator region of the operon and prevents RNA polymerase from transcribing the operon.
c) In presence of an inducer, such as lactose or allolactose, the repressor is inactivated by the interaction with inducer. This allows RNA polymerase access to the promoter and transcription proceeds.

v) Regulation of lac operon by repressor is referred to as negative regulation.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 6.
Give the salient features of the Double helix structure of DNA.
Answer:
The salient features of a Double-Helix structure of DNA are as follows.

  1. It is made of two polynucleotide chains, where the backbone is constitued by sugar- phosphate and the bases project inside.
  2. The two chains have anti – parallel polarity. This means that if one chain has the polarity 5′ → 3′, the other has 3′ → 5′.
  3. The bases in two strands are paired through hydrogen bonds (H-bonds) forming base pairs (bp). Adenine forms two hydrogen bonds with Thymine from the opposite strand and vice-versa. Similarly Guanine is bonded with Cytosine with three hydrogen bonds. As a result, a Purine always comes opposite to a Pyramidine. This generates approximately uniform distance (20 A) between the two strands of the helix.
    TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 12
  4. The two chains are coiled in a right handed fashion. The pitch of the helix is 3.4 nm a nanometer is one billionth of a metre, that is 10-9 m) and there are roughly 10 bp in each turn. Consequently, the distance between two successive base pairs (bp) in a helix is approximately equal to 0.34 nm.
  5. The plane of one base pair stacks over the other in a double helix. This, in addition to H-bonds, confers stability of the helical structure.
    TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 13

Question 7.
Replication was allowed to take place in the presence of radioactive Deoxy-nucleotide precursors in E.coli that was a mutant for DNA ligase. Explain how the newly synthesised radioactive DNA will be when purified.
Answer:

  1. In the long DNA molecule, the replication occurs within a small opening of DNA Helix, called Replication fork.
  2. On one strand, the template with polarity (3′ – 5′) the replication is continuous.
  3. On the other strand, the template with polarity (5′ – 3′), it would be discontinuous.
  4. The discontinuously synthesized fragments are joined by the DNA ligase.
  5. When Replication was allowed to take place in the presence of radioactive Deoxy – nucleotide precusors in E.Coli that was a mutant for DNA ligase, their Okazaki fragments will not be joined.

Intext Question Answers

Question 1.
Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Answer:
Nitrogenous bases present in the list are adenine, thymine, uracil and cytocine. Nucleosides present in the list are cytidine and guanosine.

Question 2.
If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA.
Answer:
According to Chargaff’s rule, the DNA molecule should have an equal ratio of pyrimidine (cytocine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules.
% A = % T and % G = % C

If ds DNA has 20% of cytosine then according to the law, it would have 20% of guanine. Thus percentage of G + C content = 40%. The remaining 60% represents both A + T molecules. Since adenine and guanine are always present in equal number the percentage of adenine molecule is 30%.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 3.
If the sequence of one strand of ONA is written as follows :
Write down the sequence of complementary strand in 3′ → 5′ direction.
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
Answer:
The DNA strand are complementary to each other with respect to base sequence. Hence if the sequence of one strand of DNA is
5′ ATGCATGCATGCATGCATGCATGCATGC -3′

Then the sequence of complementary strand in
3′ TACGTACGTACGTACGTACGTACGTACG – 5′ direction.

Therefore the sequence of nucleotides in DNA polypeptide direction in 5′ – GCATGCATGCATGCATGCATGCATGCAT 3′.

Question 4.
If the sequence of the coding strand in a transcription unit is written as follows : 5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′. Write down the sequence of mRNA.
Answer:
If the coding strand in a transcription unit is 5′ ATGCATGCATGCATGCATGCATGC ATGC 3′ Then the template strand in 3′ to 5′ direction would be 3′ TACGTACGTACGTACGTACGTACGTACG 5′

It is known that the sequence of mRNA is same on the coding strand of DNA. However, in RNA, thymine is replaced by uracil. Hence the sequence of mRNA will be 5′ AUGCAUGCAUGC AUGC AUGC AUGC – 3′

Question 5.
Which property of DNA double helix led Watson and Crick to hypothesise semiconservative mode of DNA replication? Explain.
Answer:
Watson and Crick observed that the two strands of DNA are anti parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semiconservative. It means that the double stranded DNA molecule separates and then each of the separated strand acts as a template for the synthesise of a new complementary strand. As a result, each DNA molecule would have one parental strand and a newly synthesized daughter strand. Since only one parental strand is conserved in each daughter molecule. It is semi-conservative mode of replication.
TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 14

Question 6.
Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.
Answer:
There are two different types of polymerases.

  1. DNA – dependent DNA polymerases.
  2. DNA dependent RNA polymerases.

The DNA dependent DNA polymerases use a DNA template for synthesizing a new strand of DNA. Where as DNA-dependent RNA polymerases use a DNA template strand for synthesizing DNA.

Question 7.
How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Answer:
Viruses grown in the presence of radioactive phosphorus contained radioactive DNA but not radioactive protein because DNA contains phosphorus but protein does not. Similarly viruses grown on radioactive sulphur contained radioactive protein but not radioactive DNA because DNA does not contain sulphur.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 8.
Differentiate between the followings :
a) mRNA and tRNA
b) Template strand and Coding strand.
Answer:
a) mRNA is a single stranded and unfolded polynucleotide molecule. It carries a genetic information required for the synthesis of a specific protein from DNA to ribosomes in the form of triplet codons.

tRNA is the smallest RNA also called soluble RNA (sRNA) or Adaptor RNA or Translator RNA. It is like clover leaf. It is single stranded which is folded forming three distinct loops and a 4th indistinct loop which is considered as accessory arm along with a tail.

b) DNA at promoter sites gives two single strands, one of which is called template strand which is transcribed where as the other strand is called coding strand which does not code for anything and is not transcribed.

Question 9.
List two essential roles of ribosome during translation.
Answer:
Ribosomes are responsible for protein synthesis. The ribosomes consists of structural RNAs and about 80 different proteins. In its inactive state, it exists as two subunits : a large subunit and a small subunit. When the small subunit encounter an mRNA, the process of translation of the mRNA to proteins begins. There afe two sites in the large subunit for subsequent amino acids to bind to and thus be close enough to each other for the formation of a peptide bond. The ribosome also acts as a catalyst for the formation of a peptide bond.

Question 10.
In the medium where E.coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
Answer:

  • Lactose is the inducer for lac operon.
  • The active form of lactose binds to the repressor protein and brings about a conformational change in the repressor.
  • As a result the repressor is inactive i.e., it cannot bind to the operator.
  • This provides access of the RNA polymerase to structural genes and transcription and production of enzymes continue and metabolism of lactose takes place.
  • In its absence, the repressor is active and binds to the operator. There by switching off the process.

Question 11.
Explain (in one or two lines) the function of the followings :
a) Promoter b) t RNA c) Exons t
Answer:
a) Promoter :
It is a region of DNA where RNA polymerase binds and initiates transcription.

b) t RNA :
Transfer RNA is an adaptor molecule, that is used by all living organisms to bridge the genetic code in messenger RNA with the twenty amino acids in proteins. tRNA carry amino acids to ribosomes, where they are linked into proteins.

c) Exons :
In eukaryotes, the monocistronic structural genes have interrupted coding sequences – the genes in eukaryotes are split. The coding sequences or expressed sequences are defined as Exons. Exons are interrupted by introns.

Question 12.
Briefly describe the following:
a) Transcription
b) Translation
Answer:
a) Transcription :
Transfer of the genetic information from the DNA blue print to the mRNA is called transcription.

b) Translation :
Arrangement of aminoacids in a linear, specific sequence and formation of polypeptide chain according to the specific sequence of the information written on the m RNA is called translation.

Question 13.
How the polymerization of nucleotides can be prevented in a DNA molecule.
Answer:
DNA polymerases on their own cannot initiate the process of replication. By removing primer DNA template and absence of DNA polymerase.

Question 14.
In an experiment, DNA is treated with a compound which tends to place itself amongst the stacks of nitrogenous base pairs. As a result of this, the distance between two consecutive base pairs increases from 0.34 nm to 0.44 nm calculate the length of DNA double helix (which has 2 Ɨ 109 bp) in the presence of saturating amount of this compound.
Answer:
Distance between 2 consecutive base pair in 0.44 nm (0.44 Ɨ 10-9 m)
The length of DNA double helix = 6.6 Ɨ 2 Ɨ 109 bp Ɨ 0.44 Ɨ 10-9 m / bp = 5.8 metres.

Question 15.
Recall the experiments done by Frederick Griffith. Where DNA was speculated to be the genetic material. If RNA, instead of DNA was the genetic material, would the heat killed strain of Pneumococcus have transformed the R-strain into virulent strain? Explain.
Answer:
Heat, which killed the bacteria, at least did not destroy some of the properties of the genetic material.

Moreover 2′ – OH group present at every nucleotide in RNA is a reactive group and makes RNA liable and easily degradable.

RNA is known to be catalyst hence reactive.

So, If RNA instead of DNA was the genetic material, the heat killed strain of pseudococcus could not transform the R-strain into virulent strain.

Question 16.
You are repeating the Hershey-Chase experiment and are provided with two isotopes: 32P and 15N (in place of 35S in the original experiment). How do you expect your results to be different?
Answer:
Harshey and Chase worked to discover whether it was protein or DNA from the virus that entered the bacteria.

If we repeat the same experiment by using two isotopes 32P and 15N (in place of 35S in the original experiment) we cannot distinguish the difference between the protein or DNA.

32P and 15N both are present in DNA in the Bacteria which was infected with virus. But we can not distinguish that protein did not enter the bacteria.

Question 17.
Do you think that the alternate splicing of exons may enable a structural gene to code for serveral isoproteins from one and the same gene? If yes, how? If not, why so?
Answer:
Yes. A gene is split into several sections separated by non-coding segments of DNA. Such genes are called discontinuous genes or split genes.

In split genes there are two sections – introns and exons.

Introns are non-coding sections of DNA segment. Before translation, the introns have to be removed and the exons reattached to produce a final copy of mRNA with continuous codons. This is called gene splicing.

According to the one gene one protein hypothesis of Beadle’arnd Tatum, each gene will separately code for one protein and that genes do not overlap.

So alternative splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene.

TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance

Question 18.
Can you recall what centrifugal force is, and think why a molecule with higher mass / density would sediment faster?
Answer:
Centrifugal force is the force that acts away from the centre of the circle. Higher mass / density will be thrown towards outside because heavier particles experience more centrifugal force. So they would sediment faster.

Question 19.
Do Retroviruses follow central Dogma? Give one example.
Answer:
Francis Crick proposed the central dogma in molecular biology, which states that genetic information flows from
TS Inter 2nd Year Botany Study Material Chapter 10 Molecular Basis of Inheritance 15
Retroviruses do not follow central dogma.

Retroviruses contain RNA as genetic material flow information in the reverse direction, that is from RNA to DNA.
Example: HIV

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation

Telangana TSBIEĀ TS Inter 2nd Year Botany Study Material 9th Lesson Principles of Inheritance and Variation Textbook Questions and Answers.

TS Inter 2nd Year Botany Study Material 9th Lesson Principles of Inheritance and Variation

Very Short Answer Type Questions

Question 1.
What is the cross between the Fa progeny and the homozygous recessive parent called? How is it useful?
Answer:

  1. The cross between the Ft progeny -having dominant phenotype and the homozygous recessive parent is called Test cross.
  2. The progenies of such a cross can be easily analysed and the genotype of the test organism can be determined.

Question 2.
Do you think Mendel’s laws of inheritance would have been different if the characters that he chose were located on the same chromosome?
Answer:

  1. Yes, Mendel’s law of independent assortment would not be true for the genes that are located on the same chromosome.
  2. Linkage refers to the physical association of genes on a chromosome and are called linked genes.

Question 3.
Who proposed the Chromosome theory of Inheritance? [Mar. 2019, 17]
Answer:

  1. Walter Sutton and Theodore Boveri.
  2. They used chromosomal segregation during meiosis to explain Mendel’s laws.

Question 4.
Define true breeding. Mention its significance.
Answer:

  1. A true breeding line is one that has undergone continuous self pollination.
  2. It shows the stable trait inheritance and expression for several generations.

Question 5.
Explain the terms phenotype and genotype. [May ’17, Mar. ’14]
Answer:

  1. The physical or external appearance of a character (trait) is called phenotype.
  2. The genetic makeup of an individual is called genotype.

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation

Question 6.
What is point mutation? Give an example. [Mar. ’18, May ’14]
Answer:

  1. The mutation that occurs in a single base pair of DNA molecule is called gene mutation or point mutation.
  2. A classical example for point mutation is sickle cell anemia.

Question 7.
A person has to perform crosses for the purpose of studying inheritance of a few traits / characters. What should be the criteria for selecting the organisms?
Answer:

  1. Organism must have well defined characteristics, can be grown and crossed easily.
  2. It possess bisexual flowers and can be self fertilized conveniently.
  3. It must have short life cycle and produce large number of offsprings.

Question 8.
In order to obtain the F1 generation, Mendel pollinated a pure-breeding tall plant with a pure breeding dwarf plant. But, to get the F2 generation, he simply self-pollinated the tall F1 plants. Why?
Answer:

  1. Pure breedingtall and dwarf plants are homozygous and give the same on self pollination. So he bred pure tall with pure dwarf to produce a hybrid.
  2. Mendel selfed the F1 to understand the inheritance of tall and dwarf characters and to know fate of suppressed trait in F2.

Question 9.
How are alleles of a particular gene differ from each other? Explain its significance.
Answer:

  1. Alleles are slightly different forms of the same gene ie., they differ by a single base pair.
  2. They are significant in understanding inheritance and behaviour of the genetic polymorphs.

Question 10.
In a monohybrid cross between red and white flowered plants, a geneticist got only red flowered plants. On self-pollinating these Ft plants, he got both red and white flow¬ered plants in 3 :1 ratio. Explain the basis of using RR and rr symbols to represent the genotype of plants of parental generation.
Answer:

  1. Red flowered plant crossed with white flowered plant gave red flowered F1 plant and hence red is dominant over white.
  2. In general, first letter of the dominant allele (Red) is used as symbol (R) to denote the genotype and its respective recesssive allele (white) is denoted by small letter (r).

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation

Question 11.
What is the genetic nature of wrinkled phenotype of pea seeds? [Mar. 2020]
Answer:

  1. Wrinkled character of seed in pea is a recessive tract.
  2. Hence genotype of wrinkled phenotype for pea seeds is ‘rr’

Short Answer Type Questions

Question 1.
In a Mendelian monohybrid cross, the F2 generation shows identical genotypic and phenotypic ratios. What does it tell us about the nature of alleles involved? Justify your answer.
Answer:
Incomplete dominance :
It is the phenomenon in which neither of the genes is completely dominant or completely recessive. As a result, the hybrid shows intermediate character. For example, the inheritance of flower colour in the dog flower. (Snapdragon or Antirrhinum sp). The cross between true breeding (homozygous) red flower (RR) and true breeding (homozygous) white flower plant (rr) F1 (R r) was pink.
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 1

The phenotypic ratio deviates from Mendelian monohybrid ratio of 3 : 1 to 1 : 2 : 1 (Red flower – 1, Pink flowers – 2, White flower -1) since the heterozygous / hybrid shows a different phenotype genotype ratio remains the same as Mendelian ratio 1 : 2 : 1.

Question 2.
Mention the advantages of selecting pea plant for experiment by Mendel. [Mar. 2018, ’17 ’14]
Answer:

  1. It is an annual plant that has well defined characteristics.
  2. It can be grown and crossed easily.
  3. It has bisexual flowers containing both female and male parts.
  4. It can be self fertilized coveniently.
  5. It has a short life cycle and produces large number of offsprings.

Question 3.
Differentiate between the following :
a) Dominant and Recessive [Mar. 2020]
b) Homozygous and Heterozygous [Mar. 2020]
c) Monohybrid and Dihybrid.
Answer:
a) The character which is expressed in F1 generation is called dominant and that which is unexpressed is called recessive.

b) Parents carrying similar genes such as TT or tt are called homozygous and the parents with unlike genes like Tt are called heterozygous.

c) Cross involving two parents differing in only one character is called Monohybrid cross. For example, cross between tall (TT) and dwarf (tt) parents. Cross involving two parents differing in two characters is called a Dihybrid cross. For example, cross between pea plant having yellow round seeds (YYRR) with homozygous pea plant having green wrinkled seeds (yyrr).

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation

Question 4.
Explain the Law of Dominance using a monohybrid cross. [May 2017]
Answer:
Mendel observed that in F1 hybrids the character of tallness dominated or supress the dwarf character. The character which is expressed in F1 generation is called dominant trait and that which remained unexpressed is called recessive trait.

Based on his observation on monohybrid crosses, Mendel proposed Law of Dominance.

Law of Dominance :

  1. Characters are controlled by discrete units called factors.
  2. Factors occur in pairs.
  3. In a dissimilar pair of factors pertaining to a character one member of the pair dominates (dominant) the other (recessive).

The Law of Dominance is used to explain the expression of only one of the parental characters in a monohybrid cross in the F1 and the expression of both in the F2. It also explains the proportion of 3 : 1 obtained at the F2.
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 2
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 3

The phenotypic ratio is 3 Tall: 1 Dwarf.
The genotypic ratio is 1 TT, 2Tt, 1 tt.

Question 5.
Define and design a test -cross.
Answer:

  1. When the F1 individuals are crossed with the recessive parent or organism similar in phenotype and genotype to the recessive parent, it is called test cross.
  2. Test cross is used to test whether an individual is homozygous (pure) or heterozygous (hybrid).
  3. A monohybrid test cross gives a phenotypic ratio of 1 : 1

Monohybrid Test cross
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 4

Question 6.
Using a punnet square, work out the distribution of phenotypic features in the first filial generation after a cross between a homozygous female and a heterozygous male for a single locus.
Answer:
Punnett square is a graphical representation to calculate the probability of the offsprings.
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 5

  1. No recessive individuals are obtained in the progeny.
  2. All the plants show phenotypically dominant character.
  3. They show a genotypic ratio 1 : 1.
  4. This is a test cross.

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation

Question 7.
When a cross is made between tall plant with yellow seeds (It Yy) and a tall plant with green seeds (Tt yy). What proportion of phenotype in the offspring is expected to be
a) tall and green?
b) dwarf and green?
Answer:
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 6
a) Tall and green – 3/S
b) Dwarf and green – 1/8

Question 8.
Explain the following terms with examples. [May 2014]
a) Co-dominance
b) Incomplete dominance
Answer:
a) Co-dominance :
It is the phenomenon In which both the genes are equally dominant and so the character of both genes is well expressed in next generation. So in F1 generation regeneration resemble both parents.

Examples are different types of red blood cells that determine ABO blood grouping in human beings and seed coat pattern and size in lentil plants.

Lentil is a major grain legume (pulse) crop in N. America, A cross between pure-breed- ing spotted (having a few big irregular pathes) lentils and pure breeding dotted (having several small circular dots) lentils produce heterozygotes that are both spotted and dotted. Thus it shows the phenotypic features of both parents, which means that neither the spotted nor the dotted allele is dominant or recessive to the other.
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 7

b) Incomplete dominance :
It is the phenomenon in which neither of the genes is completely dominant or completely recessive. As a result the hybrid shows intermediate character. For example, the inheritance of flower colour in the dog flower. (Snapdragon or Antirrhinum sp). The cross between true breeding (homozygous) red flower (RR) and true breeding (homozygous) white flower plant (rr) F1 (R r) was pink.
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 8

The phenotypic ratio deviates from Mendelian monohybrid ratio of 3 : 1 to 1 : 2 : 1 (Red flower -1, Pink flowers – 2, White flower -1) since the heterozygous / hybrid shows a different phenotype genotype ratio remains the same as Mendelian ratio 1 : 2 : 1.

Question 9.
Write a brief note on chromosomal mutations and gene mutations.
Answer:
Chromosomal Mutation :
Any change in structure and No. of chromosome is called chromosomal mutation.

  1. Loss or gain of a segment of DNA, results in alternation in chromosomes. Because genes are located on chromosomes, alteration in chromosomes results in abnormalities.
  2. Chromosomal alternations are common in cancer cells.

Gene Mutation :
Mutation that occurs due to change in a single base pair of DNA is called Gene Mutation or point mutation. E.g.: Sickle cell anaemia. Deletion and insertion of base pairs of DNA, Cancer from shift mutation.

Question 10.
How was it concluded that genes are located on chromosomes?
Answer:
Morgar hybridised yellow bodied and white eyed females to brown bodied, red eyed males and intercrossed their F1 progeny. He observed that the two genes did not segregate independently with each other and the F2 ratio deviated very significantly from the 9 : 3 : 3 : 1 ratio. He saw quickly that when the two genes in a dihybrid cross were situated on the same chromosome, the proportion of parental combinations was much higher than the non – parental type. He attributed this due to the physical association or linkage of the two genes and coined the term linkage and the term recombination to describe the generation of non parental gene combinations. He also found that, even when genes were grouped on the same chromosome, some genes were tightly linked and some genes were loosely linked.

Alfred Sturtevant used the frequency of recombination between gene pairs on the same chromosome as a measure of distance between genes and mapped their position on the chromosome.

Question 11.
A plant with red flowers was crossed with one having yellow flowers. If F1 showed all flowers in orange colour, explain the inheritance.
Answer:
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 10
The cross between red flower and yellow flower, showed all orange colour flowers in F1 generation. This shows that neither of the genes is completely dominant or completely recessive. As a result, the hybrid shows intermediate character. This is incomplete dominance.

Question 12.
Define Law of Segregation and Law of Independent Assortment.
Answer:
Law of Segregation or law of purity of gametes :
Based on the results obtained from the monohybrid cross Mendel postulated the first law “the law of segregation or law of purity of gametes.” It states that the two alleles of a gene when present together in a heterozygous state, do not fuse or blend in any way, but remain distinct and segregate during meiosis or in the formation of gametes so that each meiotic product or gamete will carry only one of them.

Law of Independent Assortment :
Based on the results of the dihybrid crosses in pea plant, Mendel postulated his second law known as “the law of Independent Assortment.” Which states that “when the plants differ from each other in two or more pairs of contrasting characters or factors, then the inheritance of one pair of factors is independent to that of the other pair of factors.

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation

Question 13.
In peas, tallness is dominant over dwarfness and violet colour of flowers is dominant over the white colour. When a tall plant bearing violet flowers was pollinated with a dwarf plant bearing white flowers, different phenotypic groups were obtained in the progeny in numbers mentioned against them.
Tall, violet = 138 Dwarf, violet = 136
Tall, white = 132 Dwarf, white = 128
Mention the genotypes of the two parents and of the four offspring types.
Answer:
When a tall plant bearing violet flowers was pollinated with a dwarf plant bearing white flowers, the different phenotypic groups were in ratio nearly 1: 1:1: 1. This is Dihybrid test cross ratio. The genotype of two parents Tt Vv (Tall violet) and tt vv (Dwarf white)Ā TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 11

Question 14.
How do genes and chromosomes share similarity from the view point of genetical studies?
Answer:
Chromosomes are made up of DNA and proteins DNA is a special kind of molecules made up of nucleotides. There are four types of nucleotides. A DNA molecule consists of a long string of nucleotide pairs linked together. The sequence of nucleotide forms a code gene refer to a specific sequence of this DNA code that actually means characters all genes are DNA but not all the DNA are the genes.

Chromosomes are DNA molecule made up of a sequence of nucleotides. Genes are stretches of DNA that contain code to make protein. Thus both chromosome and genes are similar from the point of genetic studies.

Question 15.
With the help of an example differentiate between incomplete dominance and com-plete dominance.
Answer:
Incomplete dominance :
It is the phenomenon in which neither of the two alleles of a gene is completely dominant over the other.

  1. The inheritance of flower colour in dog flower / snap dragon (Antirrhinum majus) and that in Mirabilis jalapa (4 o’ clock plant) are examples of this phenomenon.
  2. When a cross is made between a red flowered plant with a white flowered plant of snap dragon the F1 hybrid has pink flowers.
  3. When the F1 individual was self pollinated and an F2 raised the F2 contained individuals bearing red, pink and white flowers.

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 12
The phenotypic and genotypic ratio are same i.e., 1 Red : 2 Pink : 1 White.

Complete dominance is a phenomenon in which one allele of a gene expresses itself and suppresses the expression of the other allele of the same, when they are present to-gether in a hybrid.

  1. When a cross was made between two individuals, one with tall stem (homozygous) and the other with dwarf stem, F1 individual had tall stem.
  2. When a F1 individual is self pollinated the F2 produced tall and dwarf individuals in the ratio of 3 : 1

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 13
The phenotypic ratio is 3 Tall : 1 Dwarf.
The genotypic ratio is 1 TT : 2 T t: 111.

Long Answer Type Questions

Question 1.
In a plant, tallness is dominant over dwarfness and red flower is dominant over white. Starting with the parents workout a dihybrid cross. What is standard dihybrid ratio? Do you think the values would deviate if the two genes in question are interacting with each other?
Answer:
In a plant tallness is dominant over dwarfness and red flower is dominant over the white cross between two parents with one parent, Tall with red flowers (TT RR) and other parent, Dwarf with white flowers (tt rr). Such a cross involving two parental plants differing in two character is called dihybrid cross.

When the F1 hybrids were allowed to undergo self pollination, the F2 generation progeny was showing four kinds of phenotypes in a definite pattern.

The phenotypic ratio is 9 : 3 : 3 : 1 and the genotypic ratio is 1 : 2 : 2 : 4 : 1 : 2 : 1 : 2 : 1.

The F2 progeny showed not only the parental combination i.e., Tall with red flowers and Dwarf with white flowers but also the new combination i.e., Tall white and Dwarf red.

These new combination are produced due to genetic recombination.
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 14
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 15

The F2 progeny are Tall purple 9 ; Tall white 3 ; Dwarf purple : 3; Dwarf white 1.
The dihybrid ratio is 9 : 3 : 3 : 1.
Yes, the values would deviate if the two genes interact with each other.

Intext Question Answers

Question 1.
What will be the phenotypic ratio in the offsprings obtained from the following crosses,
a) Aa Ɨ aa b) AA Ɨ aa c) Aa Ɨ Aa d) Aa Ɨ AA
Note : Gene ‘A’ is dominant over gene ‘a’.
Answer:
a) Aa Ɨ aa – P generation
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 16
The progeny shows 1 : 1 ratio.

b) AA Ɨ aa – P generation
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 17
The progeny shows Aa hybrid.

c) Aa x Aa – P generation
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 18
The progeny shows 1 : 2 : 1, 1 AA : 2 Aa : 1 aa genotype, 3 : 1 phenotype.
d) Aa Ɨ AA – generation
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 19
All the progeny shows dominant character.

Question 2.
In garden pea, the gene T for tall is dominant over its allele for dwarf. Give the geno-types of the parents in the following crosses.
a) tall Ɨ dwarf producing all tall plants.
b) tall Ɨ tall producing 3 tall and 1 dwarf plants.
c) tall Ɨ dwarf producing half tall and half dwarf number of plants.
Answer:
a) TT Ɨ tt → Tt all tall plants.
b) Tt Ɨ Tt → 3 tall and 1 dwarf plant.
c) Tt Ɨ tt → 1 tall (T t) and 1 dwarf (t t)

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation

Question 3.
Mendel crossed pea plants producing round seeds with those producing wrinkled seeds. From a total of 7324 F2 seeds, 5474 were round and 1850 were wrinkled. Using the symbols R and r for genes, predict the :
a) the parental (p) genotypes
b) the gametes
c) F2 progeny
d) the cross between F hybrids
e) genotypes, phenotypes, genotypic frequency, phenotypic ratio of F2 progeny.
Answer:
a) The parental genotypes are RR, rr (homozygous).
b) The gametes are (R) and (r).
c) F1 progeny gene R r.
d) Cross between F1 hybrids are R r Ɨ R r.
e) Genotypes are 3
Phenotypes are 2
Genotypic frequency 1 : 2 : 1
Phenotypic ratio is 3 : 1

Question 4.
The following data was obtained from an experiment on peas. The grey coloured seed is dominant over white coloured seed. Use the letter G for grey and g for white traits. Predict genotypes of the parents in each of the following crosses.

ParentProgeny
GreyWhite
a) Grey Ɨ white164156
b) Grey Ɨ grey5919
c) White Ɨ white0100
d) Grey Ɨ grey1800

Answer:
a) Genotypes of the
Grey Ɨ white
Gg Ɨ gg

b) Grey Ɨ grey
Gg Ɨ Gg

c) White Ɨ white
gg Ɨ gg

d) Grey Ɨ grey
Gg Ɨ GG

Question 5.
In tomatoes, red fruit colour (R) is dominant to yellow (r). Suppose a tomato plant homozygous for red is crossed with one homozygous for yellow. Determine the appearance of the following.
a) the F1 b) F2, c) the offspring of a cross of the F1 back to the red parent
d) the offspring of a cross of the F1 back to the yellow parent.
Answer:
a) The appearance in F1 are all red (Rr).

b) The appearance in F2 are 3 : 1 (3 red; 1 yellow).

c) The appearance of the offspring of a cross of the F2 back to the red parent are all red (homozygous red and heterozygous red). It is back cross.

d) The appearance of the offspirng of a cross of the F1 back to the yellow parent are red and yellow in 1 : 1 ratio. It is test cross.

Question 6.
In pea, axillary position of flowers (T) is dominant over its terminal position (t). Coloured flowers (C) are dominant to white flowers (c). A true breeding plant with coloured flowers in axils is crossed to one with white terminal flowers. Give the phenotypes, genotypes and expected ratios of F2, F2 back cross and test cross progenies. What genotypic ratio is expected in the F2 progeny?
Answer:
Axillary coloured flowers Ɨ Terminal white flowers – P
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 20

All the F1 hybrids phenotypes are found to have Axillary coloured flowers.
All the F1 hybrids genotypes are T t Cc.
The phenotype ratio of F2 are 9 : 3 : 3 : 1.
The genotype ratio of F2 are 1 : 2 : 2 :4 : 1 : 2 : 1 : 2 : 1.
Dihybrid test cross ratio is 1 : 1 : 1 : 1
TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation 21

In back cross when F2 individuals are crossed with the parent having dominant traits no recessive individuals are obtained. All are Axillary coloured flowers.

Question 7.
In summer squash, a plant with white flowers and disc-shaped fruits is crossed to a plant with yellow flowers and sphere shaped fruits. The F1 hybrids had white flowers and discshaped fruits. Which phenotypes are dominant? Give the genotypes of the parents and the hybrids. If these hybrids are selfed and 256 progeny are obtained. What would be the frequencies of the various phenotypes?
Answer:
The dominant phenotypes are white flowers with disc shaped fruits.
The dominant white flower (W) and recessive yellow flower (w).
The dominant disc shaped fruit (D) and recessive sphere shaped fruit (d).
The genotype of parents WWDD (white flowered disc shaped fruits) and wwdd (yellow flower and sphere shaped fruits).
The genotype of hybrid yellow flower and sphere shaped fruits is WwDd.
Phenotype frequency will be 9 : B : 3 : 1 ratio.

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation

Question 8.
Give the ratios of the following:
a) Monohybrid test cross
b) Dihybrid test cross
c) F2 phenotypic ratio of monohybrid cross
d) F2 phenotypic ratio of dihybrid cross
e) F2 Genotypic ratio of monohybrid cross and
f) F2 genotypic ratio of dihybrid cross.
Answer:
a) Monohybrid test cross ratio 1 : 1
b) Dihybrid test cross ratio 1 : 1 : 1 : 1
c) F2 phenotypic ratio of monohybrid cross 3 : 1
d) F2 phenotypic ratio of dihybrid cross 9 : 3 : 3 : 1
e) F2 genotypic ratio of monohybrid cross 1 : 2 : 1
f) F2 genotypic ratio of dihybrid cross 1 : 2 : 2 : 4 : 1 : 2 : 1 : 2 : 1

Question 9.
A diploid organism is heterozygous for 4 loci. How many types of gametes can it produce?
Answer:
A diploid organism is heterozygous for 4 loci. It can produce sixteen types of gametes.

Question 10.
What is crossing over? In which stage of cell division crossing over occurs? What is its significance?
Answer:
The exchange of chromatids between non-sister chromatids leading to genetic recombination is known as crossing over. Crossing over occurs during pachytene sub stage of meiosis. Crossing over significance is

  1. It is the cause of variation and genetic recombination.
  2. It is essential for natural selection and evolution.

Question 11.
“Genes contain the information that is required to express a particular trait”. Explain.
Answer:
Mendel conducted experiments like monohyrid cross. He crossed tall and dwarf plants to study the inheritance of gene. He observed that only one of the parent traits was expressed in the F1 generation while at the F2 stage both the traits were expressed in the proportion 3 : 1. The constracting characters traits did not show any blending at.either F1 or F2 stage.

Based on these observations, Mendel proposed that something was being stably passed down, unchanged from parents to offspring through the gametes over successive generation. He called them as factors. Now a days we call them genes. Genes therefore are the units of inheritance. They contain the information that is required to express a particular trait in an organism.

Question 12.
For the expression of traits genes provide only the potentiality and the environment provides the opportunity. Comment on the veracity of the statement.
Answer:

  1. Two individuals with the same genotype may become different in phenotype when they come into contact with different environmental conditions like temperature, light, humidity are referred to as environmental variation or modifications.
  2. The phenotype of any organism is necessarily a result of the interaction of a genotype with an environment, both are absolutely necessary.
  3. Inbred lines are obtained in which genotype is uniform. One can measure the effect of environmental factors, such as amount and kind of fertilizer and type of soil in crop plants by growing members of an inbred line under different environmental conditions. They are different phenotypically.
  4. For example, sweet potatoes grown in soil rich in potassium are round and fleshy but when this element is scare they became long and spindling.
  5. Other example is the effect of temperature a hair colour in the Himalayan rabbit. The white hair on a small area of the back of this rabbit was pulled out and the animal was put in a cold room. The hair that grew in under cold condition was black. Hair is this region which grows under warm condition is white.

Then it proves that for the expression of traits gene provide only the potentiality and the environment provides the opportunity.

TS Inter 2nd Year Botany Study Material Chapter 9 Principles of Inheritance and Variation

Question 13.
Two heterozygous parents are crossed. If the two loci are linked what would be the distribution of phenotypic features in the F1 generation for a dihybrid cross?
Answer:
Linkage is defined as the coexistence of two or more genes are situated on the same chromosome and lie close to each other, then they are inherited together and are said to be linked genes. For example, a cross between yellow body and white eyes and wild type parent in a Drosophila will produce wild type and yellow white prggenies. It is because yellow bodied and white eyed genes are linked. Therefore, they are inherited together in progenies.

TS Inter 2nd Year Botany Study Material Chapter 8 Viruses

Telangana TSBIEĀ TS Inter 2nd Year Botany Study Material 8th Lesson Viruses Textbook Questions and Answers.

TS Inter 2nd Year Botany Study Material 8th Lesson Viruses

Very Short Answer Type Questions

Question 1.
Mention the living and non-living characters of viruses.
Answer:
Living characters:

  1. They contain nucleic acid.
  2. They maintain genetic continuity through multiplication and undergo mutations.
  3. The live as obligate intracellular parasites.

Non-living characters:

  1. They do not exhibit most of the life processes like growth, irritability.
  2. They are inert life less molecules.
  3. They are acellular.
  4. They do not have metabolic system.

Question 2.
What is the shape of T4 phage? What is its genetic material?
Answer:

  1. T4 phage is tadpole shaped with a large head and a tail.
  2. Genetic material is double stranded DNA.

Question 3.
What are virulent phages? Give an example.
Answer:

  1. The viruses that attack the bacterium E.coli, causes lysis of the cells are called virulent phages.
  2. Eg: T – even phages.

Question 4.
What is lysozyme and what is its function?
Answer:

  1. The viral enzyme which dissolves the plasma membrane of the host cell (bacterial cell) is called lysozyme.
  2. Lysozyme is synthesized within the cell and the bacterial cell wall breaks releasing the newly produced phage particles / virions.

Question 5.
Define ‘lysis’ and ‘burst size’ with reference to viruses and their effects on host cells.
Answer:
1. Lysis :
It is the final stage of lytic cycle, the host cell wall bursts during this phase and all the newly produced virions are released. This is known as lysis.

2. Burst size :
The number of newly synthesized phage particles released from a single host cell.

TS Inter 2nd Year Botany Study Material Chapter 8 Viruses

Question 6.
What is a prophage?
Answer:

  1. Prophase : It is the phage DNA that is incorporated into bacterial DNA and remains latent during lysogenic cycle.
  2. It is found in temperate phages and the prophase also undergoes replication.

Question 7.
What are temperate phages? Give one example.
Answer:

  1. Temperate phage: A bacteriophage whose DNA is incorporated into the host DNA to form prophase during lysogenic cycle.
  2. It does not cause immediate lysis and death of host, when they multiply Eg: Coliphase-Ī».

Question 8.
Mention the differences between virulent phages and temperate phages.
Answer:
1. Virulent phages :
Bacteriophages that cause lysis of host at the end of replication (lytic cycle) Eg: T-even phages.

2. Temperate phages :
Bacteriophages, whose DNA is incorporated into host DNA to form prophases (lysogenic cycle) and do not cause immediate lysis of host. Eg: Coliphase-Ī»,.

Short Answer Type Questions

Question 1.
What is ICTV? How are viruses named?
Answer:
ICTV means International Committee on Taxonomy of Viruses. It regulates the norms of classification and nomenclature of viruses.

The ICTV scheme has only three hierarchial levels
– Family (including some sub – families)
– Genus
– Species

The family names end with the suffix ‘viridae’ while the genus names with ‘virus’ and the species names are common English expressions describing their nature.

Viruses are named after the disease they cause. Eg : Polio virus

Using the ICTV system, the virus that causes Acquired Immune Deficiency Syndrome (AIDS) in human beings is classified as :
Family : Retroviridae Genus : Lentivirus
Species : Human Immune Deficiency Virus (HIV).

TS Inter 2nd Year Botany Study Material Chapter 8 Viruses

Question 2.
Explain the chemical structure of viruses. [Mar. 2020]
Answer:

  1. All viruses consists of two basic components 1) core 2) capsid.
  2. Core is the nucleic acid that forms the genome. Capsid is the surrounding protein coat.
  3. Capsid gives shape and protection. It is made up of protein subunits called capsomeres. The no. of capsomeres is characteristic for each type of virus.
  4. Virus contains its genetic information in either double stranded (ds) DNA or single stranded (ss) DNA.
  5. Generally, viruses that infect plants have single stranded RNA and viruses that infect animals have double stranded DNA.
  6. Bacteriophages are usually ds DNA.
  7. Viral nucleic acid molecules are either circular or linear.
  8. Most viruses have a single nucleic acid molecule, but a few have more than one (Eg : HIV which has two identical molecules of RNA).

Question 3.
Write briefly about the symmetry of viruses.
Answer:
Helical virus are helical symmetry. They resemble long rods. Eg: RSbies virus and Tobacco mosaic virus.

Polyhedral symmetry :
Many plants and animals has polyhedral symmetry (many sides). Eg : Herpes simplex and polio viruses.

Binal symmetry :
Bacteriophage have both polyhedral symmetry in the head and helical symmetry in the tail sheath.
Spherical virus are enveloped virus. Eg : Influenza virus.

Question 4.
Explain the structure of TMV. [Mar. ’18 ’14; May ’17]
Answer:

  1. TMV was the first virus to be crystallized by Stanley.
  2. Fraenkel described the structure of TMV.
  3. Tobacco Mosaic Virus is a rod shaped virus. It is about 300 nm long and 18 nm in diameter, with a molecular weight of 39 x 106 Daltons.
  4. The capsid is made up of 2,130 subunits called capsomeres.
  5. Capsomeres are arranged in a helical manner around a central core of 4 nm.
  6. Each protein subunit is made up of a single polypeptide chain with 158 amino acids.
  7. Single stranded RNA is present inside the capsid and is also spirally coiled.
  8. RNA of TMV consists of 6,500 nucleotides.

TS Inter 2nd Year Botany Study Material Chapter 8 Viruses 1

Question 5.
Explain the structure of T – even bacteriophages. [Mar. 17, May’14]
Answer:
TS Inter 2nd Year Botany Study Material Chapter 8 Viruses 2

  1. The body of T-even bacteriophage can be distinguished into head and tail regions joined by a collar.
  2. The tail region includes a tail sheath, a base plate, pins and tail fibres which help the virus attach to host cell.
  3. The tail sheath aids in injecting viral DNA into the host cell.

Question 6.
Explain the lytic cycle with reference to certain viruses. [Mar. 2019]
Answer:
T – even phages that attack the bacterium E.coli cause lysis of the cells and are called virulent phages. They show lytic cycle. It involves 5 step process. They are 1. attachment 2. penetration 3. biosynthesis 4. maturation and 5. release.
TS Inter 2nd Year Botany Study Material Chapter 8 Viruses 3

1. Attachment:

  1. Contact of the virion to the surface of host bacterium is called attachment or adsorption.
  2. The phages use tail fibres for attachment to the complementary receptor sites on the bacterial cell wall.

2. Penetration :

  1. The injection of phage nucleic acid into the host cell is called penetration.
  2. The phage DNA is injected into the bacterium through the tail core like a hypodermal syringe.
  3. The capsid remains outside the bacterial cell and is referred to as ghost.

3. Biosynthesis :

  1. Once the phage DNA reaches the cytoplasm of the host cell, many copies of phage DNA, enzymes and capsid proteins are synthesized, using the cellular machinery of the host cell.
  2. Host cell do not contain any complete infective viruses.

4. Maturation :

  1. In this process bacteriophage DNA and capsids are assembled into complete virions.
  2. This period of time between the infection by a virus and the appearance of the mature virus within the cell is called the eclipse period.

5. Release :

  1. The final stage of viral multiplication is the lysis phase of the host cell and the release of virions from the host cell.
  2. The plasma membrane of the host cell gets dissolved or lysed due to viral enzyme called lysozyme.
  3. The bacterial cell wall breaks releasing the newly produced phage particles /virions.

TS Inter 2nd Year Botany Study Material Chapter 8 Viruses

Question 7.
Explain how temperate phages play a role in transduction.
Answer:
TS Inter 2nd Year Botany Study Material Chapter 8 Viruses 4

  1. In lysogenic cycle, some bacteriophages such as X (Lambda) phages do not cause lysis
    during multiplication.
  2. Instead, the phage DNA upon penetration into the E.coli gets integrated in to the circular bacterial DNA, becomes part of it and remains latent (inactive). Such phages are called temperate phages. This inserted phage DNA is now called prophage.
  3. Every time the bacterial genetic material replicates, the prophage also gets replication. The prophage remains latent in the progeny cells.
  4. However, rarely prophage gets disintegrated when they are exposed to UV light or some chemicals and enter into lytic cycle.
  5. Thus temperate phase plays a role of transduction by the transfer of genetic material from one bacterium to another through bacteriophage.

Question 8.
Mention the differences between lytic and lysogenic cycles.
Answer:

Lytic cycleLysogenic cycle
1. At the end of lytic cycle, bacterial cell undergoes lysis.1. Bacterial cell does not undergo immediate lysis.
2. The entry of viral DNA brings about the degradation of bacterial DNA.2. Bacterial DNA is not destroyed and viral DNA gets incorporated.
3. Prophages are not formed and the virulent phages do not allow bacteria to survive.3. Prophages persists in close relationship for long period even when bacterial cell undergoes many division cycles.
4. The viruses are called virulent phages. Eg : T – even phages4. The viruses are called temperate phages. Eg : Coliphage – Ī»

Long Answer Type Questions

Question 1.
Write about the discovery and structural organization of viruses.
Answer:

  1. Viruses have been causing diseases in humans, animals and plants from the ancient time.
  2. ‘Germ theory of disease’ was put forth by Louis Pasteur but the agent responsible for the diseases are not known.
  3. In 1892 for the first time, the Russian pathologist Dmitri Iwanowski, while studying tobacco mosaic disease, filtered the “sap of diseased tobacco leaf” through filter which was designed to retain bacteria. However the infectious agent passed through the pores of the filter. After injecting the filtered sap into the healthy plant, he found the development of symptoms of mosaic disease in it. Unable to see any microorganism in a sap, he reported that the filterable agent was responsible for the disease.
  4. Martinus Beijerinck repeated Iwanowski’s experiments and concluded that the disease causing agent was a contagious living fluid (contagium vivum fluidum).
  5. W.M. Stanley (1935) purified the sap and announced that the virus causing mosaic disease in tobacco could be crystallized. It was named as Tobacco Mosaic Virus (TMV).
  6. Fraenkel Conrat (1956) confirmed that the genetic material of the TMV is RNA.

TS Inter 2nd Year Botany Study Material Chapter 8 Viruses

Question 2.
Describe the process of multiplication of viruses.
Answer:
The process of multiplication of viruses is done by two alternative mechanisms.
a) Lytic cycle b) Lysogenic cycle

a) Lytic cycle :
T – even phages that attack the bacterium E.coli cause lysis of the cells and are called virulent phages. They show lytic cycle. It involves 5 step process. They are 1. attachment 2. penetration 3. biosynthesis 4. maturation and 5. release.

1. Attachment:

  1. Contact of the virion to the surface of host bacterium is called attachment or adsorption.
  2. The phages use tail fibres for attachment to the complementary receptor sites on the bacterial cell wall.

2. Penetration :

  1. The injection of phage nucleic acid into the host cell is called penetration.
  2. The phage DNA is injected into the bacterium through the tail core like a hypodermal syringe.
  3. The capsid remains outside the bacterial cell and is referred to as ghost.

3. Biosynthesis :

  1. Once the phage DNA reaches the cytoplasm of the host cell, many copies of phage DNA, enzymes and capsid proteins are synthesized, using the cellular machinery of the host cell.
  2. Host cell do not contain any complete infective viruses.

4. Maturation :

  1. In this process bacteriophage DNA and capsids are assembled into complete virions.
  2. This period of time between the infection by a virus and the appearance of the mature virus within the cell is called the eclipse period.

5. Release :

  1. The final stage of viral multiplication is the lysis phase of the host cell and the release of virions from the host cell.
  2. The plasma membrane of the host cell gets dissolved or lysed due to the viral enzyme called lysozyme.
  3. The bacterial cell wall breaks releasing the newly produced phage particles / virions.

TS Inter 2nd Year Botany Study Material Chapter 8 Viruses 3

b) Lysogenic cycle :
TS Inter 2nd Year Botany Study Material Chapter 8 Viruses 4

  1. In lysogenic cycle, some bacteriophages such as X (Lambda) phages do not cause lysis during multiplication.
  2. Instead the phage DNA upon penetration into the E.coli gets integrated in to the circular bacterial DNA, becomes part of it and remains latent (inactive). Such phages are called temperate phages. This inserted phage DNA is now called prophage.
  3. Every time the bacterial genetic material replicates, the prophase also gets replication. The prophage remains latent in the progeny cells.
  4. However, rarely prophage gets disintegrated when they are exposed to UV light or some chemicals and enter into lytic cycle.
  5. Thus temperate phase plays a role of transduction by the transfer of genetic material from one bacterium to another through bacteriophage.

TS Inter 2nd Year Botany Study Material Chapter 8 Viruses 5

Intext Question Answers

Question 1.
When discussing the multiplication of viruses, Virologists prefer to call the process as replication, rather than reproduction. Why?
Answer:

  1. Viral reproduction requires a living cell to takes place. Virus do not go through mitosis
    or cytogenesis nor do they have any mitotic machinery to produce new virus.
  2. Virus cannot reproduce without a host cell or infect whereas a reproductive cell are show independent replication.
  3. The cell infected by virus die immediately (lytic cycle) or after sometime (lysogenic cycle). Hence virologist prefer to call the multiplication of viruses as replication rather than reproduction.

TS Inter 2nd Year Botany Study Material Chapter 8 Viruses

Question 2.
In dealing with public health, the approach to deal with bacterial diseases is treatment. Can you guess the nature of the general public health approach to viral diseases ? What example do you cite to support your answer?
Answer:
The most effective medical approaches to viral diseases are vaccinations to provide immunity to infection and antiviral therapy to overcome drug resistance. Antibiotics have no effect on viruses. Ex : AIDS, Viral hepatitis and many more.

TS Inter 2nd Year Botany Study Material Chapter 7 Bacteria

Telangana TSBIEĀ TS Inter 2nd Year Botany Study Material 7th Lesson Bacteria Textbook Questions and Answers.

TS Inter 2nd Year Botany Study Material 7th Lesson Bacteria

Very Short Answer Type Questions

Question 1.
Write briefly on the occurrence of micro-organisms.
Answer:

  1. Microorganisms are ubiquitous. They are found in soil, water, air, and inside living beings.
  2. They occur in a variety of foods and can withstand extreme cold, heat, and drought conditions.

Question 2.
Define Microbiology.
Answer:

  1. Microbiology is a branch of biological science that deals with the study of microorganisms like protozoa, microscopic algae, fungi (yeasts and molds) bacteria and viruses.
  2. It is concerned with structure, function, classification, ways to control and using the activities of microorganisms.

Question 3.
Name the bacteria which is a common inhabitant of human intestine. How is it used in biotechnology? [May 2014]
Answer:

  1. Escherichia coli (E.coli) is a common inhabitant of human intestine.
  2. It is used in Recombinant DNA technology for the production of insulin harmone.

Question 4.
What are pleomorphic bacteria? Give an example. [May ’17, Mar. ’14]
Answer:

  1. The bacteria that keep on changing their shape depending upon the type of environment and nutrients available are called pleomorphic bacteria.
  2. Eg : Acetobacter.

Question 5.
What is sex pilus? What is its function?
Answer:

  1. The process of conjugation requires a special conjugation apparatus called the conjugation tube or pilus or sex pilus.
  2. Its function is to transfer F plasmid from F+ donor to F recipient.

TS Inter 2nd Year Botany Study Material Chapter 7 Bacteria

Question 6.
What is a genophore? [Mar. 2019]
Answer:

  1. Bacterial chromosome is also called as genophore.
  2. It is the main genetic material of bacteria.

Question 7.
What is a plasmid? What is its significance?
Answer:

  1. Plasmids : Small circular, double stranded DNA molecules present is addition to the bacterial chromosome (genophore) in Bacteria.
  2. Plasmids contain genes, for resistance to drugs, production of toxins and enzymes. These are used as tools (vectors) in modern genetic engineering technique.

Question 8.
What is conjugation? Who discovered it and in which organism? [Mar. 2017]
Answer:

  1. Conjugation is a process, in which two live bacteria come together and the donor cell directly transfers DNA to the recipient cell.
  2. This process was first observed by Lederberg and Tatum (1946) in Escherichia coli.

Question 9.
What is transformation? Who discovered it and in which organism? [Mar. 2020]
Answer:

  1. Transformation is uptake of naked DNA fragments from the surrounding environment and the expression of that genetic information in the recipient cell.
  2. Frederick Griffith (1928) discovered it in Streptococcus pneumoniae.

Question 10.
What is transduction? Who discovered it and in which organism? [March 2010]
Answer:

  1. The transfer of genetic material from one bacterium to anotherthrough bacteriophage is known as transduction,
  2. It was discovered by Lederberg and Zinder (1951) in Salmonella typhimurium.

Short Answer Type Questions

Question 1.
Explain the importance of Microbiology.
Answer:
Microbiology is a branch of biological science that deals with the study of micro-organisms. Micro-organisms are useful in several ways for the welfare of human society.
1. Soil fertility :
Micro-organisms decompose dead plants and animals thereby enrich the soil with nutrients which are utilized by plants. Microbes also play vital role in recycling of elements like C, N, O, S, and P.

2. Antibiotics :
Alexander Fleming isolated an antibiotic Penicillin from a fungus, Penicillium notatum. Waksman isolated an antibiotic Streptomycin from a bacterium, Streptomyces griseus.

3. Industrial products :
Industrial products like enzymes, amino acids, vitamins, organic acids and alcohols are commercially produced using microbes.

4. Dairy products :
Lactobacillus, commonly known as Lactic Acid Bacteria (LAB) grows in milk and convert it to curd, which also improves its natural quality by increasing vitamin B12, food stuff, like cheese, yogurt are the byproducts of microbial growth.

5. Mining :
Metals like Uranium can be extracted with 50% reduced cost by using microbes.

6. Tools in Genetic Engineering :
Microbes are used as tools in altering the genetic make up of organisms.

7. Biocontrol agents :
Micro-organisms like Bacillus thuringiensis are used to control plant diseases and pests.,

8. Production of Biogas :
Biogas, a mixture of gases (predominantly methane) produced by the microbial activity. It may be used as fuel.

9. Exomicrobiology :
Microbes are used for the exploration of life in the outer space.

10. Sewage disposal :
Bacteria and fungi are also used in sewage disposal.

TS Inter 2nd Year Botany Study Material Chapter 7 Bacteria

Question 2.
How are bacteria classified on the basis of morphology?
Answer:
Based on their shape bacteria are classified into following types.
1. Cocci :
Spherical bacteria are called cocci. They are 6 types.
a) Monococcus : A single spherical bacterium.
b) Diplococcus : A pair of spherical bacterium.
c) Tetracocci : A group of four spherical bacteria.
d) Streptococcus : A linear chain of spherical bacteria arranged in a single row.
e) Sarcinae : Cocci arranged in cubes of eight.
f) Staphylococci : A group of cocci bacteria forming irregular shapes producing bunches.

2. Bacillus :
Elongated rod shaped bacteria are called bacillus. They are 3 types.
a) Monobacillus : A single elongated rod shaped bacterium.
b) Diplobacillus : Paired cells of bacilli.
c) Streptobacillus : Chains of bacilli appearing like straws.

TS Inter 2nd Year Botany Study Material Chapter 7 Bacteria 1

3. Spiral forms :
Vibrioid : Cells having less than one complete twist.
Spirillum : Cells that have more than one complete twist – a distinct helical shape. Spirochete : Cells are slender, long and cork-screw shaped.

4. Pleomorphic :
These bacteria change their shape depending upon the type of environment and nutrients available. This phenomenon is called pleomorphism.
Eg : Acetobacter.

Question 3.
How are bacteria classified on the basis of number and distribution of flagella?
Answer:
Based on the number and distribution of flagella bacteria are classified into 4 types.

  1. Monotrichous : A single flagellum is present on one side of the cell.
  2. Lophotrichous : A tuft of flagella are present on one side of the cell.
  3. Amphitrichous : Tufts of flagella or a single flagellum on either end of the cell.
  4. Peritrichous : Many flagella are distributed all over the cell surface.

Question 4.
What are the nutritional groups of bacteria based on their source of energy and carbon?
Answer:
Four major nutritional groups of bacteria based on the source of energy and carbon are described below.
TS Inter 2nd Year Botany Study Material Chapter 7 Bacteria 3

Question 5.
Write briefly about chemoheterotrophs and their significance.
Answer:
Chemoheterotrophs derive both carbon and energy from organic compounds. Processing these organic molecules by respiration or fermentation releases energy in the form of ATP.

These bacteria are divided into saprophytes and parasites basing on how they obtain their organic compounds.

Saprophytes :
These are free living bacteria which grow on dead, organic matter are called Saprophytes. Eg : Bacillus

Parasites :
The bacteria which grow on or in living host and cause diseases are called parasites.
Eg : Xanthomonas, Salmonella.

Significance :
Most microbes of biomedical importance belong to these two categories. Bdellovibrio bacteriovorous grows as a parasite on some harmful bacteria and their abundance is supposed to be responsible for the microbial purity of Ganges waters.

TS Inter 2nd Year Botany Study Material Chapter 7 Bacteria

Question 6.
Explain the conjugation in bacteria.
Answer:
Conjugation :

  1. The transfer of genetic material (DNA) through direct cell to cell contact is known as conjugation.
  2. It was first reported by Lederberg and Tatum in 1946 in Escherichia coli.
  3. In E.coli, in addition to the bacterial chromosome or genophore which is the main genetic material, bacteria contain small circular, double stranded DNA molecules called plasmids or ‘F’ factor.
  4. E.coli having F factor are called F+ cells or donor cells and the cells without F factor are called F cells or acceptor cells.
  5. F+ cells have pilus or sex pilus. During conjugation the F+ and F strains come close together. Once contact is established, the pilus shortens to bring the two bacteria close together.
  6. A conjugation.tube is established. The plasmid in F+ replicates and forms a copy of it, which moves to the acceptor cell (F). Thus donor bacterium generally retain a copy of genetic material that is being transferred.

Long Answer Type Questions

Question 1.
Explain different methods of sexual reproduction in Bacteria.
Answer:
Sexual reproduction :
True sexual reproduction is absent in bacteria. However the exchange of genetic material is reported through other methods.

Three types of genetic recombinations are reported in different species of bacteria. They are

  1. Conjugation
  2. Transformation and
  3. Transduction.

1. Conjugation :

  1. The transfer of genetic material (DNA) through direct cell to cell contact is known as conjugation.
  2. It was first reported by Lederberg and Tatum in 1946 in Escherichia coli.
  3. In E.coli, in addition to the bacterial chromosome or genophore which is the main genetic material, bacteria contain small circular, double stranded DNA molecules called plasmids or ‘F’ factor.
  4. E.coli having F factor are called F+ cells or donor cells and the cells without F factor are called F cells or acceptor cells.
  5. F+ cells have pilus or sex pilus. During conjugation the F+ and F strains come close together. Once contact is established, the pilus shortens to bring the two bacteria close together.
  6. A conjugation tube is established, The plasmid in F+ replicates and forms a copy of it, which moves to the acceptor cell (F). Thus donor bacterium generally retain a copy of genetic material that is being transferred.

2. Transformation :
Transformation is uptake of naked DNA fragments from the surrounding environment and the expression of that genetic information in the
recipient cell. That is, the recipient cell has now acquired a characteristic that is previously lacked. This mode of bacterial genetic recombination was discovered by Frederick Griffith in streptococcus pneumoniae.

TS Inter 2nd Year Botany Study Material Chapter 7 Bacteria

3. Transduction :
The transfer of genetic material from one bacterium to another through bacteriophage is known as transduction.

Question 2.
“Bacteria are friends and foes of man” – discuss.
Answer:
Bacteria are known to be the casual agents of plant, animal and human diseases. At the same time there are many bacteria which are directly or indirectly beneficial to man. Thus, these organisms can be considered both as ‘friends and foes of man’.

Beneficial activities:

  1. Microbes are now used in extracting valuable metals like uranium from rocks. The process is known as Bio-mining. The use of microbes in mining reduces the cost of production by more than 50%.
  2. DNA components from bacteria are used as Biosensors that can detect biologically active toxic pollutants.
  3. Microbes also find application in medical diagnostics, food and fermentation operations.
  4. The most important development in Biotechnology depends on the possibility of altering the genetic makeup of bacteria through genetic engineering.
  5. Microbes in household products :
    a) A common example is the production of curd from milk micro-organisms such as Lactobacillus and others, commonly called lactic acid bacteria (LAB), grow in milk and convert into curd. It also improves its nutritional quality by increasing vitamin B12.
    b) Some of our food stuffs like cheese, yogurt are also actually the by- products of microbial growth.
  6. Microbes are used as biocontrol agents. Biocontrol refers to the use of biological methods for controlling plant diseases and pests.
  7. Many industrial products like enzymes, amino acids, vitamins, organic acid and alcohols are commercially produced by micro organisms.
  8. Microorganism decompose dead plants and animals and enrich the soil nutrients which can be used by plants. They play an important role in recycling of elements.
  9. Microbes cause diseases in plants and human beings. On the other hand, they help in creating disease free world by producing antibiotics and vaccinations. Penicillin was the antibiotic discovered by Alexander Fleming from a fungus, penicillin notatum. The antibiotic obtained from bacteria streptomyces griseus is known as streptomycin.
  10. Biogas is a mixture of gases (containing predominantly methane) produced by the microbial activity and which may be used as fuel.

Harmful activities:
Some bacteria that cause human diseases are

BacteriumDiseases
Clostridium tetaniTetanus
Clostridium botulinumBotulism
Vibrio choleraCholera
Salmonella typhiTyphoid
Corynebacterium diphtheriaeDiphtheria
Mycobacterium tuberculosisTuberculosis
Diplococcus pneumoniaPneumonia
Mycobacterium lepraeLeprosy
Neisseria gonorrhoeaGonorrhoea
Treponema pallidumSyphilis

Bacteria causes plant diseases :

DiseaseBacterium
Blight of riceXanthomonas oryzae
Citrus cankerX. axonopodis pv. citri
Crown gall of apples and pearsAgrobacterium tumefaciens

Bacteria also cause animal diseases :

DiseaseBacterium
Anthrax of sheepBacillus anthracis
Tuberculosis of dogs, cattle etc.Mycobacterium tuberculosis
Actinomycosis of cattleMycobacterium boris
VibriosisVibrio tetus

Intext Question Answers

Question 1.
Many people believe that bacteria do little more than cause human illness and infectious diseases. How does the information in this chapter help you correct that misconception?
Answer:
Most of the bacteria are beneficial activities than harmful activities.

Bacteria are known to be the casual agents of plant, animal and human diseases. At the same time there are many bacteria which are directly or indirectly beneficial to humans. Thus, these organisms can be considered both as ‘friends and foes of man’.”

Beneficial activities:

  1. Microbes are now used in extracting valuable metals like uranium from rocks. The process is known as Bio-mining. The use of microbes in mining reduces the cost of production by more than 50%.
  2. DNA components from bacteria are used as Biosensors that can detect biologically active toxic pollutants.
  3. Microbes also find application in medical diagnostics, food and fermentation operations.
  4. The most important development in Biotechnology depends on the possibility of altering the genetic makeup of bacteria through genetic engineering.
  5. Microbes in household products :
    a) A common example is the production of curd from milk micro-organisms such as Lactobacillus and others, commonly called lactic acid bacteria (LAB), grow in milk and convert into curd. It also improves its nutritional quality by increasing vitamin Bir
    b) Some of our food stuffs like cheese, yogurt are also actually the by-products of microbial growth.
  6. Microbes are used as biocontrol agents. Biocontrol refers to the use of biological methods for controlling plant diseases and pests.
  7. Many industrial products like enzymes, amino acids, vitamins, organic acid and alcohols are commercially produced by microorganisms.
  8. Microorganism decompose dead plants and animals and enrich the soil nutrients which can be used by plants. They play an important role in recycling of elements.
  9. Microbes cause diseases in plants and human being. On the other hand, they help in creating disease free world by producing antibiotics and vaccinations. Penicillin was antibiotic obtained from bacteria streptomyces griseus is known as streptomycin.
  10. Biogas is a mixture of gases (containing predominantly methane) produced by the microbial activity and which may be used as fuel.

Harmful activities:
Some bacteria that cause human diseases are

BacteriumDiseases
Clostridium tetaniTetanus
Clostridium botulinumBotulism
Vibrio choleraCholera
Salmonella typhiTyphoid
Corynebacterium diphtheriaeDiphtheria
Mycobacterium tuberculosisTuberculosis
Diplococcus pneumoniaPneumonia
Mycobacterium lepraeLeprosy
Neisseria gonorrhoeaGonorrhoea
Treponema pallidumSyphilis

Bacteria causes plant diseases ;

DiseaseBacterium
Blight of riceXanthomonas oryzae
Citrus cankerX. axonopodis pv. citri
Crown gall of apples and pearsAgrobacterium tumefaciens

Bacteria also cause animal diseases :

DiseaseBacterium
Anthrax of sheepBacillus anthracis
Tuberculosis of dogs, cattle etc.Mycobacterium tuberculosis
Actinomycosis of cattleMycobacterium boris
VibriosisVibrio tetus

TS Inter 2nd Year Botany Study Material Chapter 7 Bacteria

Question 2.
Humans produce about 50 grams of feces per day. Scientists estimated in broad terms about one -third of human feces is composed of bacteria. If one E.coli cell weighs 1 Ɨ 10-12 g, how many bacteria are there in a day’s feces? How can this be possible?
Answer:
Feces per day = 50 gram
Bacteria present = \(\frac{1}{3}\) Ɨ 50 gm
Each bacteria weight = 1 Ɨ 10-12 gm
Bacteria in a day’s feces = \(\frac{1}{3}\) Ɨ 50 Ɨ 1 Ɨ 10-12 gm
i.e., 16.66 Ɨ 10-12(approx)

Question 3.
An organism is described as a peritrichous bacillus. How might you translate this bacteriological language into a description of the organism?
Answer:
Bacillus indicates that bacteria are rod elongated in shape. Peritrichous indicates that bacteria is having many flagella distributed all over the cell surface flagella are locomotory in function.